FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637785_at:

>probe:Drosophila_2:1637785_at:230:293; Interrogation_Position=2059; Antisense; CGATCTCAGATCGAGGGCTAGCTAA
>probe:Drosophila_2:1637785_at:171:333; Interrogation_Position=2084; Antisense; GCTGGCAGGGATTTTGGAGTCACCA
>probe:Drosophila_2:1637785_at:713:549; Interrogation_Position=2099; Antisense; GGAGTCACCACTACGTACACATAAA
>probe:Drosophila_2:1637785_at:440:21; Interrogation_Position=2125; Antisense; ATATCAGCTCGCAATCTGCATAATT
>probe:Drosophila_2:1637785_at:36:271; Interrogation_Position=2143; Antisense; CATAATTTGTTTGCCTGTCGCCTAG
>probe:Drosophila_2:1637785_at:352:319; Interrogation_Position=2170; Antisense; GCCGCCTTCAAAATTGTTTTCGCTA
>probe:Drosophila_2:1637785_at:615:223; Interrogation_Position=2224; Antisense; AAGGATACACGAAGCGCCTTCCACA
>probe:Drosophila_2:1637785_at:168:241; Interrogation_Position=2259; Antisense; AATACCCACATGTCCTTCATATAAC
>probe:Drosophila_2:1637785_at:509:29; Interrogation_Position=2368; Antisense; ATACATCGCCTATAAGTTTTCTTTC
>probe:Drosophila_2:1637785_at:684:61; Interrogation_Position=2420; Antisense; ATGTGTATTTTCTTCGTTCGACGAG
>probe:Drosophila_2:1637785_at:226:471; Interrogation_Position=2435; Antisense; GTTCGACGAGTGTACGCCTATCATC
>probe:Drosophila_2:1637785_at:626:683; Interrogation_Position=2453; Antisense; TATCATCGGCTGTTGCACATTGAGT
>probe:Drosophila_2:1637785_at:380:369; Interrogation_Position=2571; Antisense; GAATGCCATCAGCTTCAGCTGTGAC
>probe:Drosophila_2:1637785_at:130:613; Interrogation_Position=2592; Antisense; TGACACAGGCAAGACGCATCACAAA

Paste this into a BLAST search page for me
CGATCTCAGATCGAGGGCTAGCTAAGCTGGCAGGGATTTTGGAGTCACCAGGAGTCACCACTACGTACACATAAAATATCAGCTCGCAATCTGCATAATTCATAATTTGTTTGCCTGTCGCCTAGGCCGCCTTCAAAATTGTTTTCGCTAAAGGATACACGAAGCGCCTTCCACAAATACCCACATGTCCTTCATATAACATACATCGCCTATAAGTTTTCTTTCATGTGTATTTTCTTCGTTCGACGAGGTTCGACGAGTGTACGCCTATCATCTATCATCGGCTGTTGCACATTGAGTGAATGCCATCAGCTTCAGCTGTGACTGACACAGGCAAGACGCATCACAAA

Full Affymetrix probeset data:

Annotations for 1637785_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720