FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637788_at:

>probe:Drosophila_2:1637788_at:554:239; Interrogation_Position=1953; Antisense; AATAACACACCCCATAGCTAAAGAA
>probe:Drosophila_2:1637788_at:577:77; Interrogation_Position=1987; Antisense; AGGATCCTAAATAACTGCCCTCCTT
>probe:Drosophila_2:1637788_at:545:31; Interrogation_Position=1997; Antisense; ATAACTGCCCTCCTTTATCTTATTT
>probe:Drosophila_2:1637788_at:591:699; Interrogation_Position=2020; Antisense; TTTATCTGCTTTGCTTAACTGCCCT
>probe:Drosophila_2:1637788_at:123:709; Interrogation_Position=2034; Antisense; TTAACTGCCCTCCTTTATCTTATTT
>probe:Drosophila_2:1637788_at:284:39; Interrogation_Position=2060; Antisense; ATCTGCTTTGCTGTACATTCTGGTA
>probe:Drosophila_2:1637788_at:329:539; Interrogation_Position=2081; Antisense; GGTAGACTGACATTTTAATATCCTT
>probe:Drosophila_2:1637788_at:507:243; Interrogation_Position=2097; Antisense; AATATCCTTTCTATAGTTCCTCTCG
>probe:Drosophila_2:1637788_at:282:453; Interrogation_Position=2121; Antisense; GATCACCCTATCCTAAAACAGTATT
>probe:Drosophila_2:1637788_at:524:701; Interrogation_Position=2144; Antisense; TTTTCCATATTTTCTCATCTTCCGA
>probe:Drosophila_2:1637788_at:575:19; Interrogation_Position=2160; Antisense; ATCTTCCGAAATCTTTCCTCACCAA
>probe:Drosophila_2:1637788_at:293:279; Interrogation_Position=2177; Antisense; CTCACCAACACACCCGAAAATAATT
>probe:Drosophila_2:1637788_at:326:217; Interrogation_Position=2331; Antisense; AAGTCTGTTTTGTGTATGTGTGTAT
>probe:Drosophila_2:1637788_at:133:165; Interrogation_Position=2399; Antisense; AAATCACCTTTCAAATCCACACAAA

Paste this into a BLAST search page for me
AATAACACACCCCATAGCTAAAGAAAGGATCCTAAATAACTGCCCTCCTTATAACTGCCCTCCTTTATCTTATTTTTTATCTGCTTTGCTTAACTGCCCTTTAACTGCCCTCCTTTATCTTATTTATCTGCTTTGCTGTACATTCTGGTAGGTAGACTGACATTTTAATATCCTTAATATCCTTTCTATAGTTCCTCTCGGATCACCCTATCCTAAAACAGTATTTTTTCCATATTTTCTCATCTTCCGAATCTTCCGAAATCTTTCCTCACCAACTCACCAACACACCCGAAAATAATTAAGTCTGTTTTGTGTATGTGTGTATAAATCACCTTTCAAATCCACACAAA

Full Affymetrix probeset data:

Annotations for 1637788_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720