Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637790_a_at:

>probe:Drosophila_2:1637790_a_at:359:183; Interrogation_Position=107; Antisense; AAAATGGCGCTTCGTCTTACGACCA
>probe:Drosophila_2:1637790_a_at:625:497; Interrogation_Position=120; Antisense; GTCTTACGACCATTGCTCTTCTACA
>probe:Drosophila_2:1637790_a_at:658:411; Interrogation_Position=127; Antisense; GACCATTGCTCTTCTACACCGTGCT
>probe:Drosophila_2:1637790_a_at:623:665; Interrogation_Position=141; Antisense; TACACCGTGCTCCTTTATTAGTTGT
>probe:Drosophila_2:1637790_a_at:372:509; Interrogation_Position=147; Antisense; GTGCTCCTTTATTAGTTGTGCCAAA
>probe:Drosophila_2:1637790_a_at:619:307; Interrogation_Position=166; Antisense; GCCAAAGTTAAAAGCAACACCGCCA
>probe:Drosophila_2:1637790_a_at:140:299; Interrogation_Position=186; Antisense; CGCCAACACGCACTCTATTGTTAAG
>probe:Drosophila_2:1637790_a_at:24:157; Interrogation_Position=191; Antisense; ACACGCACTCTATTGTTAAGAAAGA
>probe:Drosophila_2:1637790_a_at:691:207; Interrogation_Position=212; Antisense; AAGAATCTGGTACCGTTTTTAGATG
>probe:Drosophila_2:1637790_a_at:518:285; Interrogation_Position=218; Antisense; CTGGTACCGTTTTTAGATGATGATC
>probe:Drosophila_2:1637790_a_at:96:445; Interrogation_Position=233; Antisense; GATGATGATCCTTGTGTGTTCTCAA
>probe:Drosophila_2:1637790_a_at:97:445; Interrogation_Position=236; Antisense; GATGATCCTTGTGTGTTCTCAAAGA
>probe:Drosophila_2:1637790_a_at:267:471; Interrogation_Position=250; Antisense; GTTCTCAAAGAAAGCCGTCATGCAT
>probe:Drosophila_2:1637790_a_at:599:211; Interrogation_Position=257; Antisense; AAGAAAGCCGTCATGCATCATTGGG

Paste this into a BLAST search page for me
AAAATGGCGCTTCGTCTTACGACCAGTCTTACGACCATTGCTCTTCTACAGACCATTGCTCTTCTACACCGTGCTTACACCGTGCTCCTTTATTAGTTGTGTGCTCCTTTATTAGTTGTGCCAAAGCCAAAGTTAAAAGCAACACCGCCACGCCAACACGCACTCTATTGTTAAGACACGCACTCTATTGTTAAGAAAGAAAGAATCTGGTACCGTTTTTAGATGCTGGTACCGTTTTTAGATGATGATCGATGATGATCCTTGTGTGTTCTCAAGATGATCCTTGTGTGTTCTCAAAGAGTTCTCAAAGAAAGCCGTCATGCATAAGAAAGCCGTCATGCATCATTGGG

Full Affymetrix probeset data:

Annotations for 1637790_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime