FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637791_at:

>probe:Drosophila_2:1637791_at:324:611; Interrogation_Position=128; Antisense; TGAAGCGTTACGAGGATCCCAAAAA
>probe:Drosophila_2:1637791_at:507:213; Interrogation_Position=164; Antisense; AAGAGCGGCAGAAAACTCCTTGCAA
>probe:Drosophila_2:1637791_at:74:623; Interrogation_Position=180; Antisense; TCCTTGCAAGCGATACTTTGGCAGT
>probe:Drosophila_2:1637791_at:511:7; Interrogation_Position=224; Antisense; ATTGCAAGTTTACCCACTATAGTGG
>probe:Drosophila_2:1637791_at:552:169; Interrogation_Position=23; Antisense; AAAGTTATTATTGCGACTACTGCTG
>probe:Drosophila_2:1637791_at:15:523; Interrogation_Position=245; Antisense; GTGGCGATAATCTACGGGAACTGGA
>probe:Drosophila_2:1637791_at:151:159; Interrogation_Position=317; Antisense; ACAAATGCAAGAGATGGCCCTGGAA
>probe:Drosophila_2:1637791_at:84:583; Interrogation_Position=331; Antisense; TGGCCCTGGAAAACTCATCTGCGAA
>probe:Drosophila_2:1637791_at:112:145; Interrogation_Position=343; Antisense; ACTCATCTGCGAAAGGGATTACCCC
>probe:Drosophila_2:1637791_at:199:405; Interrogation_Position=37; Antisense; GACTACTGCTGTTGCTTTCTGAAAA
>probe:Drosophila_2:1637791_at:408:251; Interrogation_Position=403; Antisense; CAAACCGACTTTGAACTCAGTTGGG
>probe:Drosophila_2:1637791_at:481:619; Interrogation_Position=474; Antisense; TGCTAATTACTTTCTCCATGACGCG
>probe:Drosophila_2:1637791_at:332:269; Interrogation_Position=490; Antisense; CATGACGCGCGCCACTTTCAGGTTG
>probe:Drosophila_2:1637791_at:727:159; Interrogation_Position=86; Antisense; ACAATGGTGGTATTGCACACGCAAT

Paste this into a BLAST search page for me
TGAAGCGTTACGAGGATCCCAAAAAAAGAGCGGCAGAAAACTCCTTGCAATCCTTGCAAGCGATACTTTGGCAGTATTGCAAGTTTACCCACTATAGTGGAAAGTTATTATTGCGACTACTGCTGGTGGCGATAATCTACGGGAACTGGAACAAATGCAAGAGATGGCCCTGGAATGGCCCTGGAAAACTCATCTGCGAAACTCATCTGCGAAAGGGATTACCCCGACTACTGCTGTTGCTTTCTGAAAACAAACCGACTTTGAACTCAGTTGGGTGCTAATTACTTTCTCCATGACGCGCATGACGCGCGCCACTTTCAGGTTGACAATGGTGGTATTGCACACGCAAT

Full Affymetrix probeset data:

Annotations for 1637791_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720