Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637792_at:

>probe:Drosophila_2:1637792_at:542:167; Interrogation_Position=4749; Antisense; AAATGTGTATATGTCCCGGAAACCG
>probe:Drosophila_2:1637792_at:704:391; Interrogation_Position=4791; Antisense; GAAACCTCCCACAAACTGTGCTAAA
>probe:Drosophila_2:1637792_at:445:453; Interrogation_Position=4913; Antisense; GATCTAGCTGACTAACGATGTGAAA
>probe:Drosophila_2:1637792_at:437:197; Interrogation_Position=5008; Antisense; AACGAAGCCCAATCAAATCTATGTG
>probe:Drosophila_2:1637792_at:487:679; Interrogation_Position=5051; Antisense; TAGTCGATAATGTTAACTCTCTCTC
>probe:Drosophila_2:1637792_at:409:219; Interrogation_Position=5083; Antisense; AAGTCCATCAATCCATACACCGTGT
>probe:Drosophila_2:1637792_at:318:665; Interrogation_Position=5098; Antisense; TACACCGTGTGTTTCATTTTATTCC
>probe:Drosophila_2:1637792_at:553:697; Interrogation_Position=5109; Antisense; TTTCATTTTATTCCGTAGCCTACCT
>probe:Drosophila_2:1637792_at:209:669; Interrogation_Position=5124; Antisense; TAGCCTACCTATCTACGTTTGTATC
>probe:Drosophila_2:1637792_at:210:481; Interrogation_Position=5140; Antisense; GTTTGTATCTCTAACGCTCGCTGTA
>probe:Drosophila_2:1637792_at:263:199; Interrogation_Position=5152; Antisense; AACGCTCGCTGTATCTACATACAAT
>probe:Drosophila_2:1637792_at:627:479; Interrogation_Position=5183; Antisense; GTATCTCTAACTGTATCTGTAAACC
>probe:Drosophila_2:1637792_at:494:685; Interrogation_Position=5196; Antisense; TATCTGTAAACCATCACCGATCCGA
>probe:Drosophila_2:1637792_at:159:125; Interrogation_Position=5220; Antisense; ACCACAACCGATCACACTCTAAAAG

Paste this into a BLAST search page for me
AAATGTGTATATGTCCCGGAAACCGGAAACCTCCCACAAACTGTGCTAAAGATCTAGCTGACTAACGATGTGAAAAACGAAGCCCAATCAAATCTATGTGTAGTCGATAATGTTAACTCTCTCTCAAGTCCATCAATCCATACACCGTGTTACACCGTGTGTTTCATTTTATTCCTTTCATTTTATTCCGTAGCCTACCTTAGCCTACCTATCTACGTTTGTATCGTTTGTATCTCTAACGCTCGCTGTAAACGCTCGCTGTATCTACATACAATGTATCTCTAACTGTATCTGTAAACCTATCTGTAAACCATCACCGATCCGAACCACAACCGATCACACTCTAAAAG

Full Affymetrix probeset data:

Annotations for 1637792_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime