FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637793_at:

>probe:Drosophila_2:1637793_at:573:589; Interrogation_Position=1979; Antisense; TGGTCCATCTTGAGGCCGTCTTTGA
>probe:Drosophila_2:1637793_at:296:305; Interrogation_Position=1994; Antisense; CCGTCTTTGACGTGATGGATCTCTA
>probe:Drosophila_2:1637793_at:304:441; Interrogation_Position=2007; Antisense; GATGGATCTCTATCGGTTCATGGAT
>probe:Drosophila_2:1637793_at:471:541; Interrogation_Position=2021; Antisense; GGTTCATGGATCTCTTCCCTGAAGC
>probe:Drosophila_2:1637793_at:304:285; Interrogation_Position=2039; Antisense; CTGAAGCGGCCTACGTGCGAGATGC
>probe:Drosophila_2:1637793_at:199:521; Interrogation_Position=2094; Antisense; GGGCGTTTTTCAAATAACTCGCTTG
>probe:Drosophila_2:1637793_at:21:35; Interrogation_Position=2154; Antisense; ATCAAACTATGCAATCCGCCGAATA
>probe:Drosophila_2:1637793_at:138:659; Interrogation_Position=2177; Antisense; TAACGCACGTGAAGGAGCCTCGTCT
>probe:Drosophila_2:1637793_at:227:519; Interrogation_Position=2216; Antisense; GTGGCCGTCTCACCGAAAGGTTACT
>probe:Drosophila_2:1637793_at:21:51; Interrogation_Position=2233; Antisense; AGGTTACTTGCACAGGGTCTTCTTA
>probe:Drosophila_2:1637793_at:297:707; Interrogation_Position=2255; Antisense; TTACCCCAGGCATGCTTAGCGAGCT
>probe:Drosophila_2:1637793_at:675:593; Interrogation_Position=2290; Antisense; TGGGACGCCCAGCAACTTGGCAAAT
>probe:Drosophila_2:1637793_at:727:653; Interrogation_Position=2370; Antisense; TAATTACTCAGGGATCGGGCGAAAG
>probe:Drosophila_2:1637793_at:719:381; Interrogation_Position=2417; Antisense; GAACGTGCCAGCTCAGGATTAGTTA

Paste this into a BLAST search page for me
TGGTCCATCTTGAGGCCGTCTTTGACCGTCTTTGACGTGATGGATCTCTAGATGGATCTCTATCGGTTCATGGATGGTTCATGGATCTCTTCCCTGAAGCCTGAAGCGGCCTACGTGCGAGATGCGGGCGTTTTTCAAATAACTCGCTTGATCAAACTATGCAATCCGCCGAATATAACGCACGTGAAGGAGCCTCGTCTGTGGCCGTCTCACCGAAAGGTTACTAGGTTACTTGCACAGGGTCTTCTTATTACCCCAGGCATGCTTAGCGAGCTTGGGACGCCCAGCAACTTGGCAAATTAATTACTCAGGGATCGGGCGAAAGGAACGTGCCAGCTCAGGATTAGTTA

Full Affymetrix probeset data:

Annotations for 1637793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720