FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637794_at:

>probe:Drosophila_2:1637794_at:4:451; Interrogation_Position=298; Antisense; GATCCCAACTATGATGGCCCCAAGT
>probe:Drosophila_2:1637794_at:270:581; Interrogation_Position=312; Antisense; TGGCCCCAAGTACGTGGTCAGATTG
>probe:Drosophila_2:1637794_at:148:243; Interrogation_Position=352; Antisense; AATAGCACCACGGATGATGCCCAGC
>probe:Drosophila_2:1637794_at:668:543; Interrogation_Position=381; Antisense; GGATTTCCGGGTACTCAACTATGTG
>probe:Drosophila_2:1637794_at:53:193; Interrogation_Position=397; Antisense; AACTATGTGGTGCATCCGGCGTACG
>probe:Drosophila_2:1637794_at:357:403; Interrogation_Position=486; Antisense; GACTTTCAGCGAGTATGTGGCACCT
>probe:Drosophila_2:1637794_at:118:639; Interrogation_Position=595; Antisense; TCGTCGCATCTGCTCAAGGTGAGTC
>probe:Drosophila_2:1637794_at:144:161; Interrogation_Position=662; Antisense; ACAAGATCGATGTGCGCACCCAATT
>probe:Drosophila_2:1637794_at:38:249; Interrogation_Position=683; Antisense; AATTGTGTGCGGGATCGCGGTCCAC
>probe:Drosophila_2:1637794_at:199:289; Interrogation_Position=700; Antisense; CGGTCCACCAGTGCGGATACTTGTT
>probe:Drosophila_2:1637794_at:40:457; Interrogation_Position=715; Antisense; GATACTTGTTATGGCGACTCCGGCG
>probe:Drosophila_2:1637794_at:241:271; Interrogation_Position=757; Antisense; CATCCCATATATTCGTGCCTGAAGC
>probe:Drosophila_2:1637794_at:617:3; Interrogation_Position=787; Antisense; ATTGGCATCACCTCCTATGGATTGG
>probe:Drosophila_2:1637794_at:478:527; Interrogation_Position=825; Antisense; GGGACTGCCCAGTGTGTACACCAAA

Paste this into a BLAST search page for me
GATCCCAACTATGATGGCCCCAAGTTGGCCCCAAGTACGTGGTCAGATTGAATAGCACCACGGATGATGCCCAGCGGATTTCCGGGTACTCAACTATGTGAACTATGTGGTGCATCCGGCGTACGGACTTTCAGCGAGTATGTGGCACCTTCGTCGCATCTGCTCAAGGTGAGTCACAAGATCGATGTGCGCACCCAATTAATTGTGTGCGGGATCGCGGTCCACCGGTCCACCAGTGCGGATACTTGTTGATACTTGTTATGGCGACTCCGGCGCATCCCATATATTCGTGCCTGAAGCATTGGCATCACCTCCTATGGATTGGGGGACTGCCCAGTGTGTACACCAAA

Full Affymetrix probeset data:

Annotations for 1637794_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720