FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637795_at:

>probe:Drosophila_2:1637795_at:617:271; Interrogation_Position=1023; Antisense; CATTACCCGGTGCTTTAGTCTAGTA
>probe:Drosophila_2:1637795_at:393:493; Interrogation_Position=1040; Antisense; GTCTAGTATTCCTCGTTTCTTTAAG
>probe:Drosophila_2:1637795_at:98:699; Interrogation_Position=1059; Antisense; TTTAAGGCGAACTCACACACTCATC
>probe:Drosophila_2:1637795_at:535:35; Interrogation_Position=1081; Antisense; ATCAGTCCGCGCTCATAGTTAAGTG
>probe:Drosophila_2:1637795_at:330:659; Interrogation_Position=1200; Antisense; TAACCAAATGTAACGCTCCAGGCGA
>probe:Drosophila_2:1637795_at:168:129; Interrogation_Position=665; Antisense; ACCACCCGTTTGGTGCCAGTGAATA
>probe:Drosophila_2:1637795_at:723:259; Interrogation_Position=712; Antisense; CACGTCATCGCTGGCAATCAGGCAA
>probe:Drosophila_2:1637795_at:227:83; Interrogation_Position=740; Antisense; AGGGCGGTGATCGATACCGACTACA
>probe:Drosophila_2:1637795_at:253:619; Interrogation_Position=773; Antisense; TGCTATTCCGTTCAGGTTTCAGTGA
>probe:Drosophila_2:1637795_at:254:229; Interrogation_Position=797; Antisense; AATGGCACAATGTCGACGGATCGCG
>probe:Drosophila_2:1637795_at:497:269; Interrogation_Position=841; Antisense; CATGGAAGGTGTTTGCGAGCAGCTA
>probe:Drosophila_2:1637795_at:572:615; Interrogation_Position=899; Antisense; TGCAATCCGTGCAGTATGAACGCCT
>probe:Drosophila_2:1637795_at:498:55; Interrogation_Position=914; Antisense; ATGAACGCCTGTAACGGCAGCTCGG
>probe:Drosophila_2:1637795_at:305:353; Interrogation_Position=994; Antisense; GCAGCGCAACTAGAGACACGATCAT

Paste this into a BLAST search page for me
CATTACCCGGTGCTTTAGTCTAGTAGTCTAGTATTCCTCGTTTCTTTAAGTTTAAGGCGAACTCACACACTCATCATCAGTCCGCGCTCATAGTTAAGTGTAACCAAATGTAACGCTCCAGGCGAACCACCCGTTTGGTGCCAGTGAATACACGTCATCGCTGGCAATCAGGCAAAGGGCGGTGATCGATACCGACTACATGCTATTCCGTTCAGGTTTCAGTGAAATGGCACAATGTCGACGGATCGCGCATGGAAGGTGTTTGCGAGCAGCTATGCAATCCGTGCAGTATGAACGCCTATGAACGCCTGTAACGGCAGCTCGGGCAGCGCAACTAGAGACACGATCAT

Full Affymetrix probeset data:

Annotations for 1637795_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720