FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637797_at:

>probe:Drosophila_2:1637797_at:1:393; Interrogation_Position=144; Antisense; GAAAGCCGACTACCCTAGAGATGTG
>probe:Drosophila_2:1637797_at:634:279; Interrogation_Position=194; Antisense; CTCTGCAGCATGTGGTGTGCCGGAA
>probe:Drosophila_2:1637797_at:208:93; Interrogation_Position=234; Antisense; AGTTCGTCATCACCTGCAGGGTTAT
>probe:Drosophila_2:1637797_at:269:81; Interrogation_Position=251; Antisense; AGGGTTATCTCATCCGCGAACAGAT
>probe:Drosophila_2:1637797_at:69:99; Interrogation_Position=272; Antisense; AGATCCGCGAGCATCTGGAGACCCT
>probe:Drosophila_2:1637797_at:7:255; Interrogation_Position=297; Antisense; CAACTGCTCTGATCTGTTCCAGCAA
>probe:Drosophila_2:1637797_at:511:111; Interrogation_Position=317; Antisense; AGCAAGCATTGCAATCCGAGGATCA
>probe:Drosophila_2:1637797_at:7:467; Interrogation_Position=360; Antisense; GTTGGCTATAGGACAGCATTCCCGT
>probe:Drosophila_2:1637797_at:535:1; Interrogation_Position=377; Antisense; ATTCCCGTAAACTCCACTGTGTGTT
>probe:Drosophila_2:1637797_at:717:369; Interrogation_Position=429; Antisense; GAAGGCAGTGATTCGTCGGACGTAC
>probe:Drosophila_2:1637797_at:487:275; Interrogation_Position=484; Antisense; CTTCTCTACCAGCTGTATATCGGCA
>probe:Drosophila_2:1637797_at:717:249; Interrogation_Position=507; Antisense; CAATCGAGAGTCCTATGCTGCAATG
>probe:Drosophila_2:1637797_at:356:543; Interrogation_Position=598; Antisense; GGATACATGGCTAAACTCTGGCAAA
>probe:Drosophila_2:1637797_at:147:467; Interrogation_Position=679; Antisense; GTTGACGCAATTATAGACCTTCTGA

Paste this into a BLAST search page for me
GAAAGCCGACTACCCTAGAGATGTGCTCTGCAGCATGTGGTGTGCCGGAAAGTTCGTCATCACCTGCAGGGTTATAGGGTTATCTCATCCGCGAACAGATAGATCCGCGAGCATCTGGAGACCCTCAACTGCTCTGATCTGTTCCAGCAAAGCAAGCATTGCAATCCGAGGATCAGTTGGCTATAGGACAGCATTCCCGTATTCCCGTAAACTCCACTGTGTGTTGAAGGCAGTGATTCGTCGGACGTACCTTCTCTACCAGCTGTATATCGGCACAATCGAGAGTCCTATGCTGCAATGGGATACATGGCTAAACTCTGGCAAAGTTGACGCAATTATAGACCTTCTGA

Full Affymetrix probeset data:

Annotations for 1637797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720