FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637798_at:

>probe:Drosophila_2:1637798_at:495:309; Interrogation_Position=585; Antisense; GCCAGTTGGCCAAAAGGGATCCCCT
>probe:Drosophila_2:1637798_at:545:669; Interrogation_Position=609; Antisense; TACCTTACGGCCAAGTTAGTCTGTG
>probe:Drosophila_2:1637798_at:146:369; Interrogation_Position=634; Antisense; GAATGAGAAGCTGGGCTGCGCCTAC
>probe:Drosophila_2:1637798_at:168:645; Interrogation_Position=656; Antisense; TACGAACTGATACCACGACTACCGA
>probe:Drosophila_2:1637798_at:198:403; Interrogation_Position=672; Antisense; GACTACCGAGCGATATTGTGGCCAT
>probe:Drosophila_2:1637798_at:599:629; Interrogation_Position=709; Antisense; TCCGGACTTGGATCCCATCTGGGAA
>probe:Drosophila_2:1637798_at:234:41; Interrogation_Position=725; Antisense; ATCTGGGAATCCTTTGCTGCCGACC
>probe:Drosophila_2:1637798_at:608:641; Interrogation_Position=760; Antisense; TCTGCTGGCCAAGAACTATCACTAT
>probe:Drosophila_2:1637798_at:174:327; Interrogation_Position=804; Antisense; GCAAACGGAGGATCGTCGTCTTTCC
>probe:Drosophila_2:1637798_at:149:519; Interrogation_Position=830; Antisense; GTGGGCACCATCTTCGGCAACTGAA
>probe:Drosophila_2:1637798_at:9:613; Interrogation_Position=858; Antisense; TGACAGTTCTGGACTTCGACGGCGA
>probe:Drosophila_2:1637798_at:690:575; Interrogation_Position=878; Antisense; GGCGACGAATCACATCCGGAAGGAA
>probe:Drosophila_2:1637798_at:164:9; Interrogation_Position=902; Antisense; ATTACATCCAGGTGCTTTTTAAGCC
>probe:Drosophila_2:1637798_at:479:569; Interrogation_Position=969; Antisense; GGCATCCTTTTCGACAGTTCAATTG

Paste this into a BLAST search page for me
GCCAGTTGGCCAAAAGGGATCCCCTTACCTTACGGCCAAGTTAGTCTGTGGAATGAGAAGCTGGGCTGCGCCTACTACGAACTGATACCACGACTACCGAGACTACCGAGCGATATTGTGGCCATTCCGGACTTGGATCCCATCTGGGAAATCTGGGAATCCTTTGCTGCCGACCTCTGCTGGCCAAGAACTATCACTATGCAAACGGAGGATCGTCGTCTTTCCGTGGGCACCATCTTCGGCAACTGAATGACAGTTCTGGACTTCGACGGCGAGGCGACGAATCACATCCGGAAGGAAATTACATCCAGGTGCTTTTTAAGCCGGCATCCTTTTCGACAGTTCAATTG

Full Affymetrix probeset data:

Annotations for 1637798_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720