FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637799_at:

>probe:Drosophila_2:1637799_at:363:11; Interrogation_Position=1507; Antisense; ATTCTGAAGGCCAGCAGCCCGAAGC
>probe:Drosophila_2:1637799_at:382:125; Interrogation_Position=1566; Antisense; AGCCTACCAGGATCGAGTTGCCAAG
>probe:Drosophila_2:1637799_at:282:589; Interrogation_Position=1648; Antisense; TGGTTTCGGTTACCCTAGATAAGTG
>probe:Drosophila_2:1637799_at:172:163; Interrogation_Position=1676; Antisense; AAATCTTCCAATTATTTACCGCGAT
>probe:Drosophila_2:1637799_at:236:191; Interrogation_Position=1723; Antisense; AACATAGGCTATGAATCTTCCGCAA
>probe:Drosophila_2:1637799_at:231:367; Interrogation_Position=1735; Antisense; GAATCTTCCGCAAAACAGTTGGCAA
>probe:Drosophila_2:1637799_at:370:255; Interrogation_Position=1757; Antisense; CAAACGATGCTTGCCTTAAAGTAAG
>probe:Drosophila_2:1637799_at:689:75; Interrogation_Position=1834; Antisense; AGGAGGCCAGGCACTGCAAGACGTA
>probe:Drosophila_2:1637799_at:177:213; Interrogation_Position=1851; Antisense; AAGACGTAGCTGTAGTCTCCGGAGA
>probe:Drosophila_2:1637799_at:17:499; Interrogation_Position=1865; Antisense; GTCTCCGGAGAGGTCGTCCTGGAAA
>probe:Drosophila_2:1637799_at:247:65; Interrogation_Position=1902; Antisense; ATGGTGAATGTGACCCAGCTTTGCC
>probe:Drosophila_2:1637799_at:26:611; Interrogation_Position=1912; Antisense; TGACCCAGCTTTGCCGTTGAGTGTA
>probe:Drosophila_2:1637799_at:680:207; Interrogation_Position=1959; Antisense; AAGCACAAACTACGCATACGACTTT
>probe:Drosophila_2:1637799_at:629:265; Interrogation_Position=1973; Antisense; CATACGACTTTGATGCGCCATAATT

Paste this into a BLAST search page for me
ATTCTGAAGGCCAGCAGCCCGAAGCAGCCTACCAGGATCGAGTTGCCAAGTGGTTTCGGTTACCCTAGATAAGTGAAATCTTCCAATTATTTACCGCGATAACATAGGCTATGAATCTTCCGCAAGAATCTTCCGCAAAACAGTTGGCAACAAACGATGCTTGCCTTAAAGTAAGAGGAGGCCAGGCACTGCAAGACGTAAAGACGTAGCTGTAGTCTCCGGAGAGTCTCCGGAGAGGTCGTCCTGGAAAATGGTGAATGTGACCCAGCTTTGCCTGACCCAGCTTTGCCGTTGAGTGTAAAGCACAAACTACGCATACGACTTTCATACGACTTTGATGCGCCATAATT

Full Affymetrix probeset data:

Annotations for 1637799_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720