Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637800_at:

>probe:Drosophila_2:1637800_at:54:389; Interrogation_Position=1135; Antisense; GAAAAGACTAGTTCCCAGCGAGCTT
>probe:Drosophila_2:1637800_at:282:123; Interrogation_Position=1151; Antisense; AGCGAGCTTATTCTCTGTCGCCTAT
>probe:Drosophila_2:1637800_at:303:687; Interrogation_Position=1173; Antisense; TATTCCATCTCCCAAGTCATACAGG
>probe:Drosophila_2:1637800_at:182:83; Interrogation_Position=1195; Antisense; AGGGCTGCGAGGAATACATCTGAAA
>probe:Drosophila_2:1637800_at:548:99; Interrogation_Position=1221; Antisense; AGCACCCAATAGTCCTGTTAATCTA
>probe:Drosophila_2:1637800_at:371:61; Interrogation_Position=1268; Antisense; ATGTCATTAGCTCACCAACAGGGAA
>probe:Drosophila_2:1637800_at:686:621; Interrogation_Position=1323; Antisense; TGCGGATGATCCATTACCTTCTCAA
>probe:Drosophila_2:1637800_at:237:215; Interrogation_Position=1361; Antisense; AAGTTAGTCCTATGGCAAGTGCGGG
>probe:Drosophila_2:1637800_at:236:29; Interrogation_Position=1400; Antisense; ATAAGAAACCTGTGCCTGAAACCTC
>probe:Drosophila_2:1637800_at:574:505; Interrogation_Position=1411; Antisense; GTGCCTGAAACCTCTTGCCAAAAAT
>probe:Drosophila_2:1637800_at:556:617; Interrogation_Position=1489; Antisense; TGCATTGTGTCCAATATGTCGCCCA
>probe:Drosophila_2:1637800_at:697:61; Interrogation_Position=1504; Antisense; ATGTCGCCCACCGAGAAAGCTCTGT
>probe:Drosophila_2:1637800_at:168:615; Interrogation_Position=1550; Antisense; TGAAGTTGGCATCGGAGCAGCACAT
>probe:Drosophila_2:1637800_at:561:351; Interrogation_Position=1566; Antisense; GCAGCACATACGTCAGGCACCAGGT

Paste this into a BLAST search page for me
GAAAAGACTAGTTCCCAGCGAGCTTAGCGAGCTTATTCTCTGTCGCCTATTATTCCATCTCCCAAGTCATACAGGAGGGCTGCGAGGAATACATCTGAAAAGCACCCAATAGTCCTGTTAATCTAATGTCATTAGCTCACCAACAGGGAATGCGGATGATCCATTACCTTCTCAAAAGTTAGTCCTATGGCAAGTGCGGGATAAGAAACCTGTGCCTGAAACCTCGTGCCTGAAACCTCTTGCCAAAAATTGCATTGTGTCCAATATGTCGCCCAATGTCGCCCACCGAGAAAGCTCTGTTGAAGTTGGCATCGGAGCAGCACATGCAGCACATACGTCAGGCACCAGGT

Full Affymetrix probeset data:

Annotations for 1637800_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime