FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637801_at:

>probe:Drosophila_2:1637801_at:376:535; Interrogation_Position=257; Antisense; GGTGCCGGCTCTAGAAATCGTGCGA
>probe:Drosophila_2:1637801_at:405:507; Interrogation_Position=297; Antisense; GTGCTCACAGAGTCGCTACTGATTT
>probe:Drosophila_2:1637801_at:665:555; Interrogation_Position=332; Antisense; GGACGAGCAGTATCCATTGCGACCA
>probe:Drosophila_2:1637801_at:730:277; Interrogation_Position=359; Antisense; CTATCCACGTGATCCGCTGAAGAAA
>probe:Drosophila_2:1637801_at:71:707; Interrogation_Position=412; Antisense; TTAGAGCGGTGTTAGGTGCCTTCTT
>probe:Drosophila_2:1637801_at:83:555; Interrogation_Position=472; Antisense; GGAGCGGCCTGGACATCTACGAAAG
>probe:Drosophila_2:1637801_at:375:121; Interrogation_Position=499; Antisense; AGCTGGCTCGACGTGGTACGGAATT
>probe:Drosophila_2:1637801_at:460:489; Interrogation_Position=514; Antisense; GTACGGAATTCTTTGGTGGCGAGCA
>probe:Drosophila_2:1637801_at:614:281; Interrogation_Position=582; Antisense; CTCGAGCTCCTTAAGTTGCAGCGTG
>probe:Drosophila_2:1637801_at:240:609; Interrogation_Position=646; Antisense; TGACCCTTTGGCTGGAACGCATGAA
>probe:Drosophila_2:1637801_at:339:427; Interrogation_Position=673; Antisense; GAGATCCGGCTGTGATGGCCTTCTA
>probe:Drosophila_2:1637801_at:461:531; Interrogation_Position=743; Antisense; GGGTCGACCCAATTACAATCTGCTG
>probe:Drosophila_2:1637801_at:518:237; Interrogation_Position=759; Antisense; AATCTGCTGGTCAAGGATGCCTGAT
>probe:Drosophila_2:1637801_at:110:51; Interrogation_Position=775; Antisense; ATGCCTGATGCACTTGGTTTATTGA

Paste this into a BLAST search page for me
GGTGCCGGCTCTAGAAATCGTGCGAGTGCTCACAGAGTCGCTACTGATTTGGACGAGCAGTATCCATTGCGACCACTATCCACGTGATCCGCTGAAGAAATTAGAGCGGTGTTAGGTGCCTTCTTGGAGCGGCCTGGACATCTACGAAAGAGCTGGCTCGACGTGGTACGGAATTGTACGGAATTCTTTGGTGGCGAGCACTCGAGCTCCTTAAGTTGCAGCGTGTGACCCTTTGGCTGGAACGCATGAAGAGATCCGGCTGTGATGGCCTTCTAGGGTCGACCCAATTACAATCTGCTGAATCTGCTGGTCAAGGATGCCTGATATGCCTGATGCACTTGGTTTATTGA

Full Affymetrix probeset data:

Annotations for 1637801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720