FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637804_at:

>probe:Drosophila_2:1637804_at:661:529; Interrogation_Position=126; Antisense; GGGATCGGAACATGCCATCAACTTC
>probe:Drosophila_2:1637804_at:440:455; Interrogation_Position=18; Antisense; GATACCGCAAACTCGAGGTGGCCAG
>probe:Drosophila_2:1637804_at:704:297; Interrogation_Position=281; Antisense; CGCAGCACTACGGACTCAACAAGAT
>probe:Drosophila_2:1637804_at:433:161; Interrogation_Position=299; Antisense; ACAAGATCTTTAACCAGCTGCCGAG
>probe:Drosophila_2:1637804_at:126:351; Interrogation_Position=330; Antisense; GCAGTATAACTCCAATGCCACGATA
>probe:Drosophila_2:1637804_at:450:491; Interrogation_Position=414; Antisense; GTACAATGGATCTCTGACCACACCA
>probe:Drosophila_2:1637804_at:637:375; Interrogation_Position=448; Antisense; GAAGCGGTCACCTGGACTGTGTTTC
>probe:Drosophila_2:1637804_at:416:593; Interrogation_Position=465; Antisense; TGTGTTTCCCGACGTTCTGGACTAT
>probe:Drosophila_2:1637804_at:150:521; Interrogation_Position=513; Antisense; GTGGAACCTCAGAGACTCACGACAA
>probe:Drosophila_2:1637804_at:682:709; Interrogation_Position=53; Antisense; TTAATGGCAGTCTCTTGCCCGGGAA
>probe:Drosophila_2:1637804_at:709:69; Interrogation_Position=538; Antisense; AGGCCCCTCATCAATAATTATCGCA
>probe:Drosophila_2:1637804_at:287:705; Interrogation_Position=555; Antisense; TTATCGCAGCATTCAGGACACCAAT
>probe:Drosophila_2:1637804_at:69:427; Interrogation_Position=584; Antisense; GAGATGTCTATTACCGAACCATTCA
>probe:Drosophila_2:1637804_at:395:243; Interrogation_Position=76; Antisense; AATTTCGAGGCCCAGAGTGTCCACT

Paste this into a BLAST search page for me
GGGATCGGAACATGCCATCAACTTCGATACCGCAAACTCGAGGTGGCCAGCGCAGCACTACGGACTCAACAAGATACAAGATCTTTAACCAGCTGCCGAGGCAGTATAACTCCAATGCCACGATAGTACAATGGATCTCTGACCACACCAGAAGCGGTCACCTGGACTGTGTTTCTGTGTTTCCCGACGTTCTGGACTATGTGGAACCTCAGAGACTCACGACAATTAATGGCAGTCTCTTGCCCGGGAAAGGCCCCTCATCAATAATTATCGCATTATCGCAGCATTCAGGACACCAATGAGATGTCTATTACCGAACCATTCAAATTTCGAGGCCCAGAGTGTCCACT

Full Affymetrix probeset data:

Annotations for 1637804_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720