FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637806_at:

>probe:Drosophila_2:1637806_at:611:85; Interrogation_Position=1002; Antisense; AGTGCATCATTCATTCGCCAGCGAA
>probe:Drosophila_2:1637806_at:497:91; Interrogation_Position=519; Antisense; AGTTTCCCTGGCTGTGGAGTTGGCA
>probe:Drosophila_2:1637806_at:329:291; Interrogation_Position=544; Antisense; CGGGCTCATCCAAATCTTATCTTAG
>probe:Drosophila_2:1637806_at:605:643; Interrogation_Position=563; Antisense; TCTTAGGCATCGATCTTAGCGGTAA
>probe:Drosophila_2:1637806_at:381:689; Interrogation_Position=621; Antisense; TATTCTTGCACAGGCCCGGGATAAG
>probe:Drosophila_2:1637806_at:730:373; Interrogation_Position=651; Antisense; GAAGTTAGCTATACACTGCGCCGAG
>probe:Drosophila_2:1637806_at:263:53; Interrogation_Position=703; Antisense; ATGCTGCACTTTGGAATGTCCCGCT
>probe:Drosophila_2:1637806_at:270:399; Interrogation_Position=731; Antisense; GACATGGAACTTTTCTTACTCCCGA
>probe:Drosophila_2:1637806_at:212:369; Interrogation_Position=793; Antisense; GAATGCTGCCTCACTAGTAATGTTA
>probe:Drosophila_2:1637806_at:429:133; Interrogation_Position=879; Antisense; ACCCAAGGTTATCTGCACGGACGAC
>probe:Drosophila_2:1637806_at:615:573; Interrogation_Position=907; Antisense; GGCGTTTTTGATACCACTTTGACAA
>probe:Drosophila_2:1637806_at:30:465; Interrogation_Position=942; Antisense; GATTGCTGCGGAAACTTTCGGTCTA
>probe:Drosophila_2:1637806_at:117:1; Interrogation_Position=960; Antisense; CGGTCTAACCCGTGAACAATGCATC
>probe:Drosophila_2:1637806_at:59:231; Interrogation_Position=977; Antisense; AATGCATCGATTTGACCTTGGAGGC

Paste this into a BLAST search page for me
AGTGCATCATTCATTCGCCAGCGAAAGTTTCCCTGGCTGTGGAGTTGGCACGGGCTCATCCAAATCTTATCTTAGTCTTAGGCATCGATCTTAGCGGTAATATTCTTGCACAGGCCCGGGATAAGGAAGTTAGCTATACACTGCGCCGAGATGCTGCACTTTGGAATGTCCCGCTGACATGGAACTTTTCTTACTCCCGAGAATGCTGCCTCACTAGTAATGTTAACCCAAGGTTATCTGCACGGACGACGGCGTTTTTGATACCACTTTGACAAGATTGCTGCGGAAACTTTCGGTCTACGGTCTAACCCGTGAACAATGCATCAATGCATCGATTTGACCTTGGAGGC

Full Affymetrix probeset data:

Annotations for 1637806_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720