FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637807_at:

>probe:Drosophila_2:1637807_at:556:45; Interrogation_Position=1719; Antisense; ATCGCCGCTGATTGGTGGTCTTTTG
>probe:Drosophila_2:1637807_at:244:341; Interrogation_Position=1751; Antisense; GCTTTTCGAATTCATGGCAGGTCAG
>probe:Drosophila_2:1637807_at:194:567; Interrogation_Position=1766; Antisense; GGCAGGTCAGGCTCCATTCGAAGGA
>probe:Drosophila_2:1637807_at:24:227; Interrogation_Position=1830; Antisense; AAGGCGGTGTTTCCAAAGCATTTCA
>probe:Drosophila_2:1637807_at:287:209; Interrogation_Position=1845; Antisense; AAGCATTTCAGCGTGGAGGCCATGG
>probe:Drosophila_2:1637807_at:57:31; Interrogation_Position=1872; Antisense; ATAATAACGAGCTTCCTGACCAAAA
>probe:Drosophila_2:1637807_at:24:677; Interrogation_Position=1907; Antisense; TAGATTGGGTGCAGGCCGCTATGCC
>probe:Drosophila_2:1637807_at:547:399; Interrogation_Position=1933; Antisense; GACAGGAGATTACCACGCATCCTTT
>probe:Drosophila_2:1637807_at:98:347; Interrogation_Position=1949; Antisense; GCATCCTTTCTTCCGGAATGTGGAC
>probe:Drosophila_2:1637807_at:563:553; Interrogation_Position=2000; Antisense; GGAGCCACCTATTAAGCCAATGATT
>probe:Drosophila_2:1637807_at:444:359; Interrogation_Position=2044; Antisense; GCAACTTTGATGATGCCTTTACCAA
>probe:Drosophila_2:1637807_at:645:139; Interrogation_Position=2075; Antisense; GACGGACTTAACTCCAACGGACAAG
>probe:Drosophila_2:1637807_at:290:461; Interrogation_Position=2137; Antisense; GATTTTCTTTCATGAATCCCGAGTT
>probe:Drosophila_2:1637807_at:648:689; Interrogation_Position=2263; Antisense; TATTGTATCCTTCGCTAAAAGCCAT

Paste this into a BLAST search page for me
ATCGCCGCTGATTGGTGGTCTTTTGGCTTTTCGAATTCATGGCAGGTCAGGGCAGGTCAGGCTCCATTCGAAGGAAAGGCGGTGTTTCCAAAGCATTTCAAAGCATTTCAGCGTGGAGGCCATGGATAATAACGAGCTTCCTGACCAAAATAGATTGGGTGCAGGCCGCTATGCCGACAGGAGATTACCACGCATCCTTTGCATCCTTTCTTCCGGAATGTGGACGGAGCCACCTATTAAGCCAATGATTGCAACTTTGATGATGCCTTTACCAAGACGGACTTAACTCCAACGGACAAGGATTTTCTTTCATGAATCCCGAGTTTATTGTATCCTTCGCTAAAAGCCAT

Full Affymetrix probeset data:

Annotations for 1637807_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720