Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637808_a_at:

>probe:Drosophila_2:1637808_a_at:671:663; Interrogation_Position=137; Antisense; TAAATAGCCATGTCGTTTGCGGAAA
>probe:Drosophila_2:1637808_a_at:35:173; Interrogation_Position=160; Antisense; AAAGATAACGGGTCTGCTGGCACGG
>probe:Drosophila_2:1637808_a_at:387:333; Interrogation_Position=175; Antisense; GCTGGCACGGCCGAATCAACAAGAT
>probe:Drosophila_2:1637808_a_at:312:447; Interrogation_Position=197; Antisense; GATCCAATTGGACCGGAGCAGCCGT
>probe:Drosophila_2:1637808_a_at:569:113; Interrogation_Position=213; Antisense; AGCAGCCGTGGTATCTCAAATATGG
>probe:Drosophila_2:1637808_a_at:409:721; Interrogation_Position=270; Antisense; TTGCCATTCTTTTCGGCCTGTGGAA
>probe:Drosophila_2:1637808_a_at:474:585; Interrogation_Position=290; Antisense; TGGAATGTGTTCTCCATCATCACGC
>probe:Drosophila_2:1637808_a_at:410:573; Interrogation_Position=334; Antisense; GGCTGGCATCCTTCAAATGGTGGCA
>probe:Drosophila_2:1637808_a_at:169:725; Interrogation_Position=363; Antisense; TTGTGGTGATGCTCTTGGAGGCTCC
>probe:Drosophila_2:1637808_a_at:320:533; Interrogation_Position=433; Antisense; GGTGGAATCTAAGCCCTTGTACTTC
>probe:Drosophila_2:1637808_a_at:536:15; Interrogation_Position=494; Antisense; ATTATTCTGTGCTTTGGACTGGCCA
>probe:Drosophila_2:1637808_a_at:366:557; Interrogation_Position=509; Antisense; GGACTGGCCAGCTTATTCGGCAGTG
>probe:Drosophila_2:1637808_a_at:425:639; Interrogation_Position=525; Antisense; TCGGCAGTGGGCTGATCTTTGGCAC
>probe:Drosophila_2:1637808_a_at:290:355; Interrogation_Position=546; Antisense; GCACTGGCGTGGTTTACGGCATGAT

Paste this into a BLAST search page for me
TAAATAGCCATGTCGTTTGCGGAAAAAAGATAACGGGTCTGCTGGCACGGGCTGGCACGGCCGAATCAACAAGATGATCCAATTGGACCGGAGCAGCCGTAGCAGCCGTGGTATCTCAAATATGGTTGCCATTCTTTTCGGCCTGTGGAATGGAATGTGTTCTCCATCATCACGCGGCTGGCATCCTTCAAATGGTGGCATTGTGGTGATGCTCTTGGAGGCTCCGGTGGAATCTAAGCCCTTGTACTTCATTATTCTGTGCTTTGGACTGGCCAGGACTGGCCAGCTTATTCGGCAGTGTCGGCAGTGGGCTGATCTTTGGCACGCACTGGCGTGGTTTACGGCATGAT

Full Affymetrix probeset data:

Annotations for 1637808_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime