FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637810_at:

>probe:Drosophila_2:1637810_at:572:9; Interrogation_Position=316; Antisense; ATTCGTCGCATTTCAGGTGGCTGGG
>probe:Drosophila_2:1637810_at:269:583; Interrogation_Position=333; Antisense; TGGCTGGGCGGATTCTGGACTCAAA
>probe:Drosophila_2:1637810_at:151:283; Interrogation_Position=378; Antisense; CTCCTTTGATGATGAGCGCTTTAAA
>probe:Drosophila_2:1637810_at:145:89; Interrogation_Position=410; Antisense; AGTCGGCTACAAATTCCATACCAAC
>probe:Drosophila_2:1637810_at:358:427; Interrogation_Position=493; Antisense; GAGATTGTAGAACCGCCAACTATTG
>probe:Drosophila_2:1637810_at:105:261; Interrogation_Position=519; Antisense; CACCTCACGATCTGCTGTTTTGAAG
>probe:Drosophila_2:1637810_at:298:247; Interrogation_Position=550; Antisense; AATTCCGATTTGCTTTCCCAGTACG
>probe:Drosophila_2:1637810_at:578:69; Interrogation_Position=569; Antisense; AGTACGCCTTTTCAGCTGTGGATGG
>probe:Drosophila_2:1637810_at:702:333; Interrogation_Position=583; Antisense; GCTGTGGATGGCTTTGATCTCTCAA
>probe:Drosophila_2:1637810_at:699:541; Interrogation_Position=624; Antisense; GGTTCCACAGGAGAGCCTCAACGAG
>probe:Drosophila_2:1637810_at:579:225; Interrogation_Position=649; Antisense; AAGGACGATCTCTGGCAGTGGGACA
>probe:Drosophila_2:1637810_at:596:527; Interrogation_Position=668; Antisense; GGGACAAGCTGTTCACCGAGGTCAC
>probe:Drosophila_2:1637810_at:151:535; Interrogation_Position=687; Antisense; GGTCACGGCTGAAATCCATTCGGAT
>probe:Drosophila_2:1637810_at:17:465; Interrogation_Position=750; Antisense; GATTCCACCCACACAATATACTTAG

Paste this into a BLAST search page for me
ATTCGTCGCATTTCAGGTGGCTGGGTGGCTGGGCGGATTCTGGACTCAAACTCCTTTGATGATGAGCGCTTTAAAAGTCGGCTACAAATTCCATACCAACGAGATTGTAGAACCGCCAACTATTGCACCTCACGATCTGCTGTTTTGAAGAATTCCGATTTGCTTTCCCAGTACGAGTACGCCTTTTCAGCTGTGGATGGGCTGTGGATGGCTTTGATCTCTCAAGGTTCCACAGGAGAGCCTCAACGAGAAGGACGATCTCTGGCAGTGGGACAGGGACAAGCTGTTCACCGAGGTCACGGTCACGGCTGAAATCCATTCGGATGATTCCACCCACACAATATACTTAG

Full Affymetrix probeset data:

Annotations for 1637810_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720