FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637812_at:

>probe:Drosophila_2:1637812_at:343:163; Interrogation_Position=127; Antisense; AAATTCGTGATGTGTTGCGGGCCCT
>probe:Drosophila_2:1637812_at:535:195; Interrogation_Position=13; Antisense; AACGGGCTCTACTGCCGAGATATAT
>probe:Drosophila_2:1637812_at:525:577; Interrogation_Position=146; Antisense; GGCCCTGCTGTGGAACTTGCTACTA
>probe:Drosophila_2:1637812_at:287:385; Interrogation_Position=158; Antisense; GAACTTGCTACTACCCTTGCTGTAG
>probe:Drosophila_2:1637812_at:348:599; Interrogation_Position=178; Antisense; TGTAGCCCCTGCTTTAGTGGCCGTT
>probe:Drosophila_2:1637812_at:690:81; Interrogation_Position=193; Antisense; AGTGGCCGTTGTTTTGGACCACGAT
>probe:Drosophila_2:1637812_at:553:729; Interrogation_Position=206; Antisense; TTGGACCACGATGCGGATTCTATAG
>probe:Drosophila_2:1637812_at:382:25; Interrogation_Position=227; Antisense; ATAGTGGACCATGTGGACCTTGCTG
>probe:Drosophila_2:1637812_at:482:101; Interrogation_Position=271; Antisense; AGCTGCGGACCGTCTTGTTAATTTT
>probe:Drosophila_2:1637812_at:267:21; Interrogation_Position=32; Antisense; ATATATTTAGTCTTACCCTGGCCTT
>probe:Drosophila_2:1637812_at:636:13; Interrogation_Position=334; Antisense; ATTAACATGGCCTATTCGTCTTGAA
>probe:Drosophila_2:1637812_at:104:663; Interrogation_Position=377; Antisense; TAAAGGTGTTTGACTTTCCAAGTCT
>probe:Drosophila_2:1637812_at:133:557; Interrogation_Position=413; Antisense; GGAACTAGATTCCTGTCCATTACCG
>probe:Drosophila_2:1637812_at:114:579; Interrogation_Position=51; Antisense; GGCCTTCAACACGACAACATCAAAA

Paste this into a BLAST search page for me
AAATTCGTGATGTGTTGCGGGCCCTAACGGGCTCTACTGCCGAGATATATGGCCCTGCTGTGGAACTTGCTACTAGAACTTGCTACTACCCTTGCTGTAGTGTAGCCCCTGCTTTAGTGGCCGTTAGTGGCCGTTGTTTTGGACCACGATTTGGACCACGATGCGGATTCTATAGATAGTGGACCATGTGGACCTTGCTGAGCTGCGGACCGTCTTGTTAATTTTATATATTTAGTCTTACCCTGGCCTTATTAACATGGCCTATTCGTCTTGAATAAAGGTGTTTGACTTTCCAAGTCTGGAACTAGATTCCTGTCCATTACCGGGCCTTCAACACGACAACATCAAAA

Full Affymetrix probeset data:

Annotations for 1637812_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720