FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637813_at:

>probe:Drosophila_2:1637813_at:369:373; Interrogation_Position=4186; Antisense; GAAGTGGATGGCTTTCACAGCGCAT
>probe:Drosophila_2:1637813_at:536:203; Interrogation_Position=4401; Antisense; AACCAGCGCTCATGTTTTTTCTCGA
>probe:Drosophila_2:1637813_at:284:59; Interrogation_Position=4412; Antisense; ATGTTTTTTCTCGATGGGATCCCTA
>probe:Drosophila_2:1637813_at:461:439; Interrogation_Position=4424; Antisense; GATGGGATCCCTACTATCCTACTGT
>probe:Drosophila_2:1637813_at:211:683; Interrogation_Position=4438; Antisense; TATCCTACTGTCCTTTGTTTTTCAA
>probe:Drosophila_2:1637813_at:640:601; Interrogation_Position=4453; Antisense; TGTTTTTCAAGTCCCACTGGTCGAG
>probe:Drosophila_2:1637813_at:243:141; Interrogation_Position=4468; Antisense; ACTGGTCGAGTGATATTCCCGGGTG
>probe:Drosophila_2:1637813_at:95:533; Interrogation_Position=4489; Antisense; GGTGGCGACAACCTTTTGCCTTGTT
>probe:Drosophila_2:1637813_at:59:721; Interrogation_Position=4504; Antisense; TTGCCTTGTTTCACAACCGGATTGA
>probe:Drosophila_2:1637813_at:614:389; Interrogation_Position=4531; Antisense; GAAACTGAGTGGCTTCTGTTCCTGT
>probe:Drosophila_2:1637813_at:627:629; Interrogation_Position=4550; Antisense; TCCTGTTCCCGCTTCAGTTTTGGTT
>probe:Drosophila_2:1637813_at:290:89; Interrogation_Position=4611; Antisense; AGTCTTATTTGGACGGCCTAGCAAA
>probe:Drosophila_2:1637813_at:617:21; Interrogation_Position=4651; Antisense; ATATTTTGTTTGAACCCTACTGCTA
>probe:Drosophila_2:1637813_at:697:379; Interrogation_Position=4662; Antisense; GAACCCTACTGCTAAAACTTCTGTT

Paste this into a BLAST search page for me
GAAGTGGATGGCTTTCACAGCGCATAACCAGCGCTCATGTTTTTTCTCGAATGTTTTTTCTCGATGGGATCCCTAGATGGGATCCCTACTATCCTACTGTTATCCTACTGTCCTTTGTTTTTCAATGTTTTTCAAGTCCCACTGGTCGAGACTGGTCGAGTGATATTCCCGGGTGGGTGGCGACAACCTTTTGCCTTGTTTTGCCTTGTTTCACAACCGGATTGAGAAACTGAGTGGCTTCTGTTCCTGTTCCTGTTCCCGCTTCAGTTTTGGTTAGTCTTATTTGGACGGCCTAGCAAAATATTTTGTTTGAACCCTACTGCTAGAACCCTACTGCTAAAACTTCTGTT

Full Affymetrix probeset data:

Annotations for 1637813_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720