Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637814_s_at:

>probe:Drosophila_2:1637814_s_at:83:581; Interrogation_Position=478; Antisense; TGGCCTGGATAAACACGCCGCGCAA
>probe:Drosophila_2:1637814_s_at:473:283; Interrogation_Position=534; Antisense; CTGCTCTCCGATCTAACGCATAAGA
>probe:Drosophila_2:1637814_s_at:70:89; Interrogation_Position=575; Antisense; AGTCTACTTGGAGTCCAGCGGTCAT
>probe:Drosophila_2:1637814_s_at:47:299; Interrogation_Position=606; Antisense; CGCGGTCTCTTCATTATCGATCAGA
>probe:Drosophila_2:1637814_s_at:562:549; Interrogation_Position=633; Antisense; GGAGTGCTGCGACAGATCACCATGA
>probe:Drosophila_2:1637814_s_at:593:555; Interrogation_Position=672; Antisense; GGACGCTCTGTGGACGAGACTATTC
>probe:Drosophila_2:1637814_s_at:515:291; Interrogation_Position=686; Antisense; CGAGACTATTCGTCTGGTTCAGGCC
>probe:Drosophila_2:1637814_s_at:7:711; Interrogation_Position=703; Antisense; TTCAGGCCTTCCAGTATACGGACAC
>probe:Drosophila_2:1637814_s_at:38:399; Interrogation_Position=723; Antisense; GACACCCATGGAGAGGTTTGCCCAG
>probe:Drosophila_2:1637814_s_at:109:295; Interrogation_Position=772; Antisense; CGATCGTTCCCAATCCTGAGGAGAA
>probe:Drosophila_2:1637814_s_at:536:149; Interrogation_Position=841; Antisense; ACATTACCTTAGTAGCCTAGCCCAG
>probe:Drosophila_2:1637814_s_at:614:305; Interrogation_Position=856; Antisense; CCTAGCCCAGTTACATTCCTAATGT
>probe:Drosophila_2:1637814_s_at:546:295; Interrogation_Position=904; Antisense; CGAACAATCGCTAGAGTCCTCTGTA
>probe:Drosophila_2:1637814_s_at:457:235; Interrogation_Position=940; Antisense; AATCCGCAATGCCACCGATTGTGAA

Paste this into a BLAST search page for me
TGGCCTGGATAAACACGCCGCGCAACTGCTCTCCGATCTAACGCATAAGAAGTCTACTTGGAGTCCAGCGGTCATCGCGGTCTCTTCATTATCGATCAGAGGAGTGCTGCGACAGATCACCATGAGGACGCTCTGTGGACGAGACTATTCCGAGACTATTCGTCTGGTTCAGGCCTTCAGGCCTTCCAGTATACGGACACGACACCCATGGAGAGGTTTGCCCAGCGATCGTTCCCAATCCTGAGGAGAAACATTACCTTAGTAGCCTAGCCCAGCCTAGCCCAGTTACATTCCTAATGTCGAACAATCGCTAGAGTCCTCTGTAAATCCGCAATGCCACCGATTGTGAA

Full Affymetrix probeset data:

Annotations for 1637814_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime