FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637819_at:

>probe:Drosophila_2:1637819_at:681:379; Interrogation_Position=4276; Antisense; GAAGCCAGGCTTAATGTTTAAGTAT
>probe:Drosophila_2:1637819_at:405:11; Interrogation_Position=4334; Antisense; ATTCATTTCCTTGAAAGCTTAGCTT
>probe:Drosophila_2:1637819_at:281:17; Interrogation_Position=4391; Antisense; ATTTTCTATCTGTATAGTGTACACG
>probe:Drosophila_2:1637819_at:208:697; Interrogation_Position=4458; Antisense; TTTCTTTCTACCGAAACAGGAGACA
>probe:Drosophila_2:1637819_at:415:163; Interrogation_Position=4482; Antisense; AAATTTGATTTACTCGGACCACTGA
>probe:Drosophila_2:1637819_at:563:639; Interrogation_Position=4495; Antisense; TCGGACCACTGATTCTGTACGTATA
>probe:Drosophila_2:1637819_at:409:285; Interrogation_Position=4509; Antisense; CTGTACGTATATGCTAACTTTGAAT
>probe:Drosophila_2:1637819_at:572:723; Interrogation_Position=4528; Antisense; TTGAATTTATCAGACATACCGGCAT
>probe:Drosophila_2:1637819_at:77:27; Interrogation_Position=4543; Antisense; ATACCGGCATATATCACATCTTTTG
>probe:Drosophila_2:1637819_at:9:31; Interrogation_Position=4555; Antisense; ATCACATCTTTTGCATATTTAAACC
>probe:Drosophila_2:1637819_at:400:681; Interrogation_Position=4588; Antisense; TATGAGTTTTTCTTCAACTTGTTAA
>probe:Drosophila_2:1637819_at:156:663; Interrogation_Position=4610; Antisense; TAAACATTTTCAATGACCTACCACC
>probe:Drosophila_2:1637819_at:181:663; Interrogation_Position=4705; Antisense; TAAACATATTATTACGTCGCTGCGT
>probe:Drosophila_2:1637819_at:684:139; Interrogation_Position=4718; Antisense; ACGTCGCTGCGTAATCAATGTGTAT

Paste this into a BLAST search page for me
GAAGCCAGGCTTAATGTTTAAGTATATTCATTTCCTTGAAAGCTTAGCTTATTTTCTATCTGTATAGTGTACACGTTTCTTTCTACCGAAACAGGAGACAAAATTTGATTTACTCGGACCACTGATCGGACCACTGATTCTGTACGTATACTGTACGTATATGCTAACTTTGAATTTGAATTTATCAGACATACCGGCATATACCGGCATATATCACATCTTTTGATCACATCTTTTGCATATTTAAACCTATGAGTTTTTCTTCAACTTGTTAATAAACATTTTCAATGACCTACCACCTAAACATATTATTACGTCGCTGCGTACGTCGCTGCGTAATCAATGTGTAT

Full Affymetrix probeset data:

Annotations for 1637819_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720