Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637820_at:

>probe:Drosophila_2:1637820_at:469:645; Interrogation_Position=4312; Antisense; TCATGAAAACGATGCCCACGTCCAT
>probe:Drosophila_2:1637820_at:665:619; Interrogation_Position=4345; Antisense; TGCTCACTGGCCAGGAAAATCCCAT
>probe:Drosophila_2:1637820_at:358:685; Interrogation_Position=4371; Antisense; TATATTTAAGCCTGCGGGAGAGTAA
>probe:Drosophila_2:1637820_at:687:395; Interrogation_Position=4595; Antisense; GACAAAGTTCGATCGGAGGCAAGTT
>probe:Drosophila_2:1637820_at:567:473; Interrogation_Position=4617; Antisense; GTTAAGATCAGCTACTACGACAAAT
>probe:Drosophila_2:1637820_at:414:379; Interrogation_Position=4647; Antisense; GAAGCGATAACTAACACACACACAA
>probe:Drosophila_2:1637820_at:359:159; Interrogation_Position=4666; Antisense; ACACAAACACATAGCACGCCTTTTT
>probe:Drosophila_2:1637820_at:423:351; Interrogation_Position=4679; Antisense; GCACGCCTTTTTGCAAAGCTTAGTA
>probe:Drosophila_2:1637820_at:157:657; Interrogation_Position=4715; Antisense; TAATGTGTGTGAGTTTGGGCCATCG
>probe:Drosophila_2:1637820_at:354:523; Interrogation_Position=4731; Antisense; GGGCCATCGGCCAGGACATACATAT
>probe:Drosophila_2:1637820_at:266:611; Interrogation_Position=4775; Antisense; TGAACAGAATGACCTTTTTGCGAAA
>probe:Drosophila_2:1637820_at:447:697; Interrogation_Position=4790; Antisense; TTTTGCGAAAACGTCCTTAGCTTAG
>probe:Drosophila_2:1637820_at:142:277; Interrogation_Position=4805; Antisense; CTTAGCTTAGTTGAACCGCGACATT
>probe:Drosophila_2:1637820_at:129:301; Interrogation_Position=4863; Antisense; CCCCATATATGCTTACCCATACTTA

Paste this into a BLAST search page for me
TCATGAAAACGATGCCCACGTCCATTGCTCACTGGCCAGGAAAATCCCATTATATTTAAGCCTGCGGGAGAGTAAGACAAAGTTCGATCGGAGGCAAGTTGTTAAGATCAGCTACTACGACAAATGAAGCGATAACTAACACACACACAAACACAAACACATAGCACGCCTTTTTGCACGCCTTTTTGCAAAGCTTAGTATAATGTGTGTGAGTTTGGGCCATCGGGGCCATCGGCCAGGACATACATATTGAACAGAATGACCTTTTTGCGAAATTTTGCGAAAACGTCCTTAGCTTAGCTTAGCTTAGTTGAACCGCGACATTCCCCATATATGCTTACCCATACTTA

Full Affymetrix probeset data:

Annotations for 1637820_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime