FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637821_at:

>probe:Drosophila_2:1637821_at:371:411; Interrogation_Position=106; Antisense; GACGCCGTTTCGTCGGATCAGGTTA
>probe:Drosophila_2:1637821_at:414:453; Interrogation_Position=121; Antisense; GATCAGGTTATCCAGTGTCCCGACG
>probe:Drosophila_2:1637821_at:359:79; Interrogation_Position=149; Antisense; AGGTTTGCACCAGCCTCCTGAAGAT
>probe:Drosophila_2:1637821_at:724:283; Interrogation_Position=166; Antisense; CTGAAGATCTGCCTGCCCAAGGGAT
>probe:Drosophila_2:1637821_at:90:223; Interrogation_Position=184; Antisense; AAGGGATCGACTCCAGCTTCCTGCA
>probe:Drosophila_2:1637821_at:333:617; Interrogation_Position=205; Antisense; TGCACTCCAGATGCCGAAATATCGT
>probe:Drosophila_2:1637821_at:730:395; Interrogation_Position=220; Antisense; GAAATATCGTGTCCTCCTTGCAGTG
>probe:Drosophila_2:1637821_at:178:617; Interrogation_Position=238; Antisense; TGCAGTGGAGCAGGTCTATTCGTCT
>probe:Drosophila_2:1637821_at:6:355; Interrogation_Position=272; Antisense; GCACCACCTTCCAAATGTGTGATGA
>probe:Drosophila_2:1637821_at:522:49; Interrogation_Position=293; Antisense; ATGAAGGCAAGCTCATCGGCCAAGT
>probe:Drosophila_2:1637821_at:201:545; Interrogation_Position=330; Antisense; GGATAACACTTTCTGCTCCATGAAG
>probe:Drosophila_2:1637821_at:707:463; Interrogation_Position=404; Antisense; GATTCGAGTGCGACAGAGAGTCCCC
>probe:Drosophila_2:1637821_at:434:517; Interrogation_Position=49; Antisense; GTGTGTCAACCAAATCATGTCAAGT
>probe:Drosophila_2:1637821_at:187:381; Interrogation_Position=82; Antisense; GAGACCCACTTTAGTTTTTGCCTCG

Paste this into a BLAST search page for me
GACGCCGTTTCGTCGGATCAGGTTAGATCAGGTTATCCAGTGTCCCGACGAGGTTTGCACCAGCCTCCTGAAGATCTGAAGATCTGCCTGCCCAAGGGATAAGGGATCGACTCCAGCTTCCTGCATGCACTCCAGATGCCGAAATATCGTGAAATATCGTGTCCTCCTTGCAGTGTGCAGTGGAGCAGGTCTATTCGTCTGCACCACCTTCCAAATGTGTGATGAATGAAGGCAAGCTCATCGGCCAAGTGGATAACACTTTCTGCTCCATGAAGGATTCGAGTGCGACAGAGAGTCCCCGTGTGTCAACCAAATCATGTCAAGTGAGACCCACTTTAGTTTTTGCCTCG

Full Affymetrix probeset data:

Annotations for 1637821_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720