FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637822_at:

>probe:Drosophila_2:1637822_at:62:395; Interrogation_Position=1120; Antisense; GAAATACCGATTCACCTGAGGTCAT
>probe:Drosophila_2:1637822_at:416:649; Interrogation_Position=1144; Antisense; TCAAATTACGTCTCGGTCTTTACCA
>probe:Drosophila_2:1637822_at:186:255; Interrogation_Position=1186; Antisense; CAGTTTACAACATGCCCCTTTACAG
>probe:Drosophila_2:1637822_at:420:583; Interrogation_Position=1276; Antisense; TGGCGGGCTTGCTAGGGACACATCC
>probe:Drosophila_2:1637822_at:380:81; Interrogation_Position=1289; Antisense; AGGGACACATCCGTGGTTACTCTTC
>probe:Drosophila_2:1637822_at:602:583; Interrogation_Position=1317; Antisense; TGGCATCTGACGGTTGAGCAGCAAC
>probe:Drosophila_2:1637822_at:147:579; Interrogation_Position=1351; Antisense; GGCCTGTTTCAGATTTTGCGCGAGT
>probe:Drosophila_2:1637822_at:467:693; Interrogation_Position=1365; Antisense; TTTGCGCGAGTATTGTGTCCCTCAC
>probe:Drosophila_2:1637822_at:641:291; Interrogation_Position=1390; Antisense; CGTACTTTCCAAGGGCGGCGCAAAT
>probe:Drosophila_2:1637822_at:534:573; Interrogation_Position=1403; Antisense; GGCGGCGCAAATGTGGTATCCCTCC
>probe:Drosophila_2:1637822_at:152:207; Interrogation_Position=1442; Antisense; AAGCGGACTATTTGCTCTGACGGCG
>probe:Drosophila_2:1637822_at:105:257; Interrogation_Position=920; Antisense; CAAAGCCTGCGATTCTGGCGAGGAT
>probe:Drosophila_2:1637822_at:700:369; Interrogation_Position=959; Antisense; GAATGTCACCACTGAGGCGCTGGAA
>probe:Drosophila_2:1637822_at:290:71; Interrogation_Position=973; Antisense; AGGCGCTGGAAGGAATTTGCTCAAA

Paste this into a BLAST search page for me
GAAATACCGATTCACCTGAGGTCATTCAAATTACGTCTCGGTCTTTACCACAGTTTACAACATGCCCCTTTACAGTGGCGGGCTTGCTAGGGACACATCCAGGGACACATCCGTGGTTACTCTTCTGGCATCTGACGGTTGAGCAGCAACGGCCTGTTTCAGATTTTGCGCGAGTTTTGCGCGAGTATTGTGTCCCTCACCGTACTTTCCAAGGGCGGCGCAAATGGCGGCGCAAATGTGGTATCCCTCCAAGCGGACTATTTGCTCTGACGGCGCAAAGCCTGCGATTCTGGCGAGGATGAATGTCACCACTGAGGCGCTGGAAAGGCGCTGGAAGGAATTTGCTCAAA

Full Affymetrix probeset data:

Annotations for 1637822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720