FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637823_at:

>probe:Drosophila_2:1637823_at:721:329; Interrogation_Position=1490; Antisense; GCGGCCATTGCCATAACGGACGAGT
>probe:Drosophila_2:1637823_at:43:141; Interrogation_Position=1505; Antisense; ACGGACGAGTACGACGGCATCATTT
>probe:Drosophila_2:1637823_at:464:345; Interrogation_Position=1521; Antisense; GCATCATTTGCCGACACATGCCATT
>probe:Drosophila_2:1637823_at:665:45; Interrogation_Position=1560; Antisense; ATCCCAGTGATAATCATCTGCCGAA
>probe:Drosophila_2:1637823_at:265:25; Interrogation_Position=1594; Antisense; ATATGTGCATGCTGTCAAAACTGGC
>probe:Drosophila_2:1637823_at:696:511; Interrogation_Position=1650; Antisense; GTGACAAATTGTTTCGCTCCATCTG
>probe:Drosophila_2:1637823_at:594:615; Interrogation_Position=1673; Antisense; TGCACGTACGATGGCCAGCGCTTTA
>probe:Drosophila_2:1637823_at:600:123; Interrogation_Position=1689; Antisense; AGCGCTTTAGTAGCTCCTTCTGGGA
>probe:Drosophila_2:1637823_at:228:397; Interrogation_Position=1796; Antisense; GACAATGGCAGCCTGCTCAACTGAG
>probe:Drosophila_2:1637823_at:719:355; Interrogation_Position=1823; Antisense; GCAAAGTTCCTCCTGTTTTATGTAA
>probe:Drosophila_2:1637823_at:461:497; Interrogation_Position=1850; Antisense; GTCATCCATTTTGGCTATGTTTTGG
>probe:Drosophila_2:1637823_at:656:361; Interrogation_Position=1913; Antisense; GCAATGGCTGTTGCAACTGCCTTAG
>probe:Drosophila_2:1637823_at:491:359; Interrogation_Position=1925; Antisense; GCAACTGCCTTAGGTGCTGGGAGCA
>probe:Drosophila_2:1637823_at:623:5; Interrogation_Position=1952; Antisense; ATCTGGACTACCTCCATTGGGTTAA

Paste this into a BLAST search page for me
GCGGCCATTGCCATAACGGACGAGTACGGACGAGTACGACGGCATCATTTGCATCATTTGCCGACACATGCCATTATCCCAGTGATAATCATCTGCCGAAATATGTGCATGCTGTCAAAACTGGCGTGACAAATTGTTTCGCTCCATCTGTGCACGTACGATGGCCAGCGCTTTAAGCGCTTTAGTAGCTCCTTCTGGGAGACAATGGCAGCCTGCTCAACTGAGGCAAAGTTCCTCCTGTTTTATGTAAGTCATCCATTTTGGCTATGTTTTGGGCAATGGCTGTTGCAACTGCCTTAGGCAACTGCCTTAGGTGCTGGGAGCAATCTGGACTACCTCCATTGGGTTAA

Full Affymetrix probeset data:

Annotations for 1637823_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720