FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637824_at:

>probe:Drosophila_2:1637824_at:198:521; Interrogation_Position=132; Antisense; GGGCGTCTTCAAGAACACACTCGGA
>probe:Drosophila_2:1637824_at:74:419; Interrogation_Position=214; Antisense; GAGCTGCTCAATCGATTCATTCTGG
>probe:Drosophila_2:1637824_at:353:587; Interrogation_Position=236; Antisense; TGGAGAACCCAAAGGCACTGCCGAA
>probe:Drosophila_2:1637824_at:29:529; Interrogation_Position=288; Antisense; GGGACTCTACAGATCCATCCTGAAG
>probe:Drosophila_2:1637824_at:701:377; Interrogation_Position=312; Antisense; GAAGCTGACGGCATCCAAGCGCATG
>probe:Drosophila_2:1637824_at:80:207; Interrogation_Position=328; Antisense; AAGCGCATGCTGAAGACCTCGTTGA
>probe:Drosophila_2:1637824_at:711:611; Interrogation_Position=350; Antisense; TGAACTTTGAACTGGCCGACAGGCC
>probe:Drosophila_2:1637824_at:639:213; Interrogation_Position=403; Antisense; AAGATCGCCGTCAAGATGGTTTCCG
>probe:Drosophila_2:1637824_at:283:317; Interrogation_Position=452; Antisense; GCCTGCTGAACTCATTCTATCTGAA
>probe:Drosophila_2:1637824_at:579:613; Interrogation_Position=473; Antisense; TGAAGCACGGAATTCCACGCAACGC
>probe:Drosophila_2:1637824_at:185:15; Interrogation_Position=509; Antisense; ATTATCCCGATCTTGACATGGCCAG
>probe:Drosophila_2:1637824_at:461:107; Interrogation_Position=605; Antisense; AGAACACTGAGTACGGATCCTTCCA
>probe:Drosophila_2:1637824_at:363:719; Interrogation_Position=625; Antisense; TTCCAGGACCTCATTATGCAGGCCA
>probe:Drosophila_2:1637824_at:159:375; Interrogation_Position=676; Antisense; GAAGAAACCAAATTGCACGGCCCCG

Paste this into a BLAST search page for me
GGGCGTCTTCAAGAACACACTCGGAGAGCTGCTCAATCGATTCATTCTGGTGGAGAACCCAAAGGCACTGCCGAAGGGACTCTACAGATCCATCCTGAAGGAAGCTGACGGCATCCAAGCGCATGAAGCGCATGCTGAAGACCTCGTTGATGAACTTTGAACTGGCCGACAGGCCAAGATCGCCGTCAAGATGGTTTCCGGCCTGCTGAACTCATTCTATCTGAATGAAGCACGGAATTCCACGCAACGCATTATCCCGATCTTGACATGGCCAGAGAACACTGAGTACGGATCCTTCCATTCCAGGACCTCATTATGCAGGCCAGAAGAAACCAAATTGCACGGCCCCG

Full Affymetrix probeset data:

Annotations for 1637824_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720