FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637825_at:

>probe:Drosophila_2:1637825_at:378:87; Interrogation_Position=1046; Antisense; AGTCCAATGGCACACGTTCGCGAAT
>probe:Drosophila_2:1637825_at:372:325; Interrogation_Position=1065; Antisense; GCGAATCCATCAACTATTACTCACG
>probe:Drosophila_2:1637825_at:127:669; Interrogation_Position=1082; Antisense; TACTCACGGACTGCTTGCTGCGGAA
>probe:Drosophila_2:1637825_at:158:129; Interrogation_Position=1181; Antisense; ACCAGGTGAAGGGATCGCTCCAGCA
>probe:Drosophila_2:1637825_at:524:427; Interrogation_Position=1228; Antisense; GAGATCACGCGCTTCGAACTGGCAA
>probe:Drosophila_2:1637825_at:277:203; Interrogation_Position=1251; Antisense; AACCATGTCCGTGTGCTTCGATGAC
>probe:Drosophila_2:1637825_at:332:195; Interrogation_Position=1283; Antisense; AACTGTTGCCCGACAACGTTCAGTA
>probe:Drosophila_2:1637825_at:86:41; Interrogation_Position=1298; Antisense; ACGTTCAGTACGACCCGGAGCGAAG
>probe:Drosophila_2:1637825_at:354:191; Interrogation_Position=1335; Antisense; AACATTGCTGAATCGCCTGGAGCTG
>probe:Drosophila_2:1637825_at:59:647; Interrogation_Position=1373; Antisense; TCTTGGCCAGTACATCCGATGTGGA
>probe:Drosophila_2:1637825_at:645:681; Interrogation_Position=1400; Antisense; TATCGTTATCAACCGGATTCGTGCA
>probe:Drosophila_2:1637825_at:246:671; Interrogation_Position=1429; Antisense; TACGTGGACTGCGACCATGTGGGCA
>probe:Drosophila_2:1637825_at:153:137; Interrogation_Position=1523; Antisense; ACGAGGTGGAGCTACTCATCCAGGA
>probe:Drosophila_2:1637825_at:111:427; Interrogation_Position=1586; Antisense; GAGAGATTGCTTGACTGCCATAAAG

Paste this into a BLAST search page for me
AGTCCAATGGCACACGTTCGCGAATGCGAATCCATCAACTATTACTCACGTACTCACGGACTGCTTGCTGCGGAAACCAGGTGAAGGGATCGCTCCAGCAGAGATCACGCGCTTCGAACTGGCAAAACCATGTCCGTGTGCTTCGATGACAACTGTTGCCCGACAACGTTCAGTAACGTTCAGTACGACCCGGAGCGAAGAACATTGCTGAATCGCCTGGAGCTGTCTTGGCCAGTACATCCGATGTGGATATCGTTATCAACCGGATTCGTGCATACGTGGACTGCGACCATGTGGGCAACGAGGTGGAGCTACTCATCCAGGAGAGAGATTGCTTGACTGCCATAAAG

Full Affymetrix probeset data:

Annotations for 1637825_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720