Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637826_at:

>probe:Drosophila_2:1637826_at:341:217; Interrogation_Position=1007; Antisense; AAGTTTGTGCCCGAGTGGATCCAGC
>probe:Drosophila_2:1637826_at:51:49; Interrogation_Position=1025; Antisense; ATCCAGCTGGGAGTGCGCATCGTTG
>probe:Drosophila_2:1637826_at:599:545; Interrogation_Position=1075; Antisense; GGACGTGTTGGCGATCCGCAAGTAC
>probe:Drosophila_2:1637826_at:646:217; Interrogation_Position=1094; Antisense; AAGTACGTCGATGGCCTCAACATAA
>probe:Drosophila_2:1637826_at:568:423; Interrogation_Position=1131; Antisense; GAGAGAACTCCGGTCACTGATAGCA
>probe:Drosophila_2:1637826_at:88:27; Interrogation_Position=1150; Antisense; ATAGCAGCCTTGTCGCTAATGCGAA
>probe:Drosophila_2:1637826_at:317:203; Interrogation_Position=1174; Antisense; AAGCTGTTTCGTGTGACTAGACCTA
>probe:Drosophila_2:1637826_at:276:411; Interrogation_Position=1193; Antisense; GACCTAGACCTATTTAGTTTGCTAA
>probe:Drosophila_2:1637826_at:433:451; Interrogation_Position=1248; Antisense; GATCAGATGGCTTCCTAATCAGCAG
>probe:Drosophila_2:1637826_at:336:157; Interrogation_Position=1307; Antisense; ACAAACACAGATTAGGCGGGCGGAC
>probe:Drosophila_2:1637826_at:534:717; Interrogation_Position=1369; Antisense; TTCGCCCAACGACTGTTTTTGCCAA
>probe:Drosophila_2:1637826_at:397:475; Interrogation_Position=1383; Antisense; GTTTTTGCCAACCTAGCTCAATTTT
>probe:Drosophila_2:1637826_at:536:191; Interrogation_Position=1473; Antisense; AACTTGCTGTGTTCTTAGCTTTCTA
>probe:Drosophila_2:1637826_at:188:117; Interrogation_Position=1489; Antisense; AGCTTTCTATTCTTTATAGCCGGAT

Paste this into a BLAST search page for me
AAGTTTGTGCCCGAGTGGATCCAGCATCCAGCTGGGAGTGCGCATCGTTGGGACGTGTTGGCGATCCGCAAGTACAAGTACGTCGATGGCCTCAACATAAGAGAGAACTCCGGTCACTGATAGCAATAGCAGCCTTGTCGCTAATGCGAAAAGCTGTTTCGTGTGACTAGACCTAGACCTAGACCTATTTAGTTTGCTAAGATCAGATGGCTTCCTAATCAGCAGACAAACACAGATTAGGCGGGCGGACTTCGCCCAACGACTGTTTTTGCCAAGTTTTTGCCAACCTAGCTCAATTTTAACTTGCTGTGTTCTTAGCTTTCTAAGCTTTCTATTCTTTATAGCCGGAT

Full Affymetrix probeset data:

Annotations for 1637826_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime