FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637827_at:

>probe:Drosophila_2:1637827_at:540:707; Interrogation_Position=1019; Antisense; TTACTTAATGTGTTCCGTCTCCTCA
>probe:Drosophila_2:1637827_at:493:279; Interrogation_Position=1037; Antisense; CTCCTCATAGTTTAGCCCCAATTTA
>probe:Drosophila_2:1637827_at:241:333; Interrogation_Position=1162; Antisense; TTTTAACCAGACATTTTCGGATTGA
>probe:Drosophila_2:1637827_at:264:423; Interrogation_Position=1195; Antisense; GAGATTTTTTCTAACTACACCGCGT
>probe:Drosophila_2:1637827_at:108:667; Interrogation_Position=1210; Antisense; TACACCGCGTACTTGCGCAAATTTT
>probe:Drosophila_2:1637827_at:61:679; Interrogation_Position=1298; Antisense; TAGTACCTAGTCTATCTGCACGAAG
>probe:Drosophila_2:1637827_at:509:715; Interrogation_Position=1364; Antisense; TTCTCTGTCTTTGTTGTACCTAAGC
>probe:Drosophila_2:1637827_at:498:107; Interrogation_Position=1393; Antisense; AGAACGCTTTAAGTTGCCCCATTGT
>probe:Drosophila_2:1637827_at:404:469; Interrogation_Position=1405; Antisense; GTTGCCCCATTGTATTATATATAGG
>probe:Drosophila_2:1637827_at:325:679; Interrogation_Position=1426; Antisense; TAGGCCTATAGGTTTTGCAAATTGT
>probe:Drosophila_2:1637827_at:305:459; Interrogation_Position=1469; Antisense; GATATACATAAGCTTCCCCTGTGTG
>probe:Drosophila_2:1637827_at:91:517; Interrogation_Position=1489; Antisense; GTGTGCCTCCCAATTGACGCAAATA
>probe:Drosophila_2:1637827_at:387:293; Interrogation_Position=952; Antisense; CGATGGCGGCATGGAGGTCTAACCC
>probe:Drosophila_2:1637827_at:166:641; Interrogation_Position=969; Antisense; TCTAACCCGGGACCTAATTGTATAT

Paste this into a BLAST search page for me
TTACTTAATGTGTTCCGTCTCCTCACTCCTCATAGTTTAGCCCCAATTTATTTTAACCAGACATTTTCGGATTGAGAGATTTTTTCTAACTACACCGCGTTACACCGCGTACTTGCGCAAATTTTTAGTACCTAGTCTATCTGCACGAAGTTCTCTGTCTTTGTTGTACCTAAGCAGAACGCTTTAAGTTGCCCCATTGTGTTGCCCCATTGTATTATATATAGGTAGGCCTATAGGTTTTGCAAATTGTGATATACATAAGCTTCCCCTGTGTGGTGTGCCTCCCAATTGACGCAAATACGATGGCGGCATGGAGGTCTAACCCTCTAACCCGGGACCTAATTGTATAT

Full Affymetrix probeset data:

Annotations for 1637827_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720