FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637829_at:

>probe:Drosophila_2:1637829_at:470:11; Interrogation_Position=1011; Antisense; ATTCGAGAAGACACTCTGGCTGCCC
>probe:Drosophila_2:1637829_at:17:149; Interrogation_Position=1051; Antisense; ACTTGTCCGGTTCTTCATTTTGTGC
>probe:Drosophila_2:1637829_at:470:67; Interrogation_Position=1099; Antisense; ATGGCCATCGTGGTGGACACTTTGC
>probe:Drosophila_2:1637829_at:423:259; Interrogation_Position=1116; Antisense; CACTTTGCTGCGTCTCTATAATGAA
>probe:Drosophila_2:1637829_at:447:445; Interrogation_Position=1152; Antisense; GATGAAGCTACAACGCCGCATATTC
>probe:Drosophila_2:1637829_at:351:413; Interrogation_Position=1209; Antisense; GACCGAGTGGCATTTTCAGAACGAC
>probe:Drosophila_2:1637829_at:539:107; Interrogation_Position=1226; Antisense; AGAACGACAATTTCCGGGCTCTGCA
>probe:Drosophila_2:1637829_at:525:319; Interrogation_Position=1248; Antisense; GCACGATGTAGTTCCGGCCAACGAA
>probe:Drosophila_2:1637829_at:449:217; Interrogation_Position=1271; Antisense; AAGTCTCCAACTTTGGCTTCATGCA
>probe:Drosophila_2:1637829_at:474:477; Interrogation_Position=1394; Antisense; GTTTTCGCGTCAAGATCTTCTACGT
>probe:Drosophila_2:1637829_at:489:37; Interrogation_Position=1408; Antisense; ATCTTCTACGTGCTGGACTTTCTTT
>probe:Drosophila_2:1637829_at:600:621; Interrogation_Position=1457; Antisense; TGCTGCGCCTGATATTCCGATTTCT
>probe:Drosophila_2:1637829_at:308:63; Interrogation_Position=923; Antisense; ATGTGGTCAACTGTGCCACGGCGAA
>probe:Drosophila_2:1637829_at:122:409; Interrogation_Position=990; Antisense; GACGTTCATCCGCAAGAATCCATTC

Paste this into a BLAST search page for me
ATTCGAGAAGACACTCTGGCTGCCCACTTGTCCGGTTCTTCATTTTGTGCATGGCCATCGTGGTGGACACTTTGCCACTTTGCTGCGTCTCTATAATGAAGATGAAGCTACAACGCCGCATATTCGACCGAGTGGCATTTTCAGAACGACAGAACGACAATTTCCGGGCTCTGCAGCACGATGTAGTTCCGGCCAACGAAAAGTCTCCAACTTTGGCTTCATGCAGTTTTCGCGTCAAGATCTTCTACGTATCTTCTACGTGCTGGACTTTCTTTTGCTGCGCCTGATATTCCGATTTCTATGTGGTCAACTGTGCCACGGCGAAGACGTTCATCCGCAAGAATCCATTC

Full Affymetrix probeset data:

Annotations for 1637829_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720