FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637833_at:

>probe:Drosophila_2:1637833_at:536:179; Interrogation_Position=1306; Antisense; AAAAATGTTTGCCACACGCCGAATC
>probe:Drosophila_2:1637833_at:273:319; Interrogation_Position=1323; Antisense; GCCGAATCCCGTCTACTTATATAGT
>probe:Drosophila_2:1637833_at:114:33; Interrogation_Position=1355; Antisense; ATCAAGGACCTCTTAGCTATGCCTC
>probe:Drosophila_2:1637833_at:592:641; Interrogation_Position=1378; Antisense; TCTGCCTATACATCCGCGAATGTGA
>probe:Drosophila_2:1637833_at:551:677; Interrogation_Position=1418; Antisense; TAGTGCACTGCGATGATCTGCTCTA
>probe:Drosophila_2:1637833_at:445:605; Interrogation_Position=1431; Antisense; TGATCTGCTCTATCTGTTCCGTAGT
>probe:Drosophila_2:1637833_at:228:689; Interrogation_Position=1513; Antisense; TTTGTTGATTACTTCGTGCACTTCG
>probe:Drosophila_2:1637833_at:82:177; Interrogation_Position=1549; Antisense; AAACCCAGGAATTCCGAGTCACTGA
>probe:Drosophila_2:1637833_at:6:621; Interrogation_Position=1579; Antisense; TGCTCCATTGAGGTGCTCCAGTCAC
>probe:Drosophila_2:1637833_at:615:139; Interrogation_Position=1602; Antisense; ACGTCCCGACGGAATATGCGACTAT
>probe:Drosophila_2:1637833_at:562:363; Interrogation_Position=1630; Antisense; GAATTCGCAAATGCACCAGATGCCT
>probe:Drosophila_2:1637833_at:2:673; Interrogation_Position=1654; Antisense; TACCAAGGCTTCGAGGTTCACGTGG
>probe:Drosophila_2:1637833_at:517:473; Interrogation_Position=1669; Antisense; GTTCACGTGGCCAGCGAATTCCAAA
>probe:Drosophila_2:1637833_at:281:675; Interrogation_Position=1740; Antisense; TAGTTCTAAACTCTGCTCAACCGAT

Paste this into a BLAST search page for me
AAAAATGTTTGCCACACGCCGAATCGCCGAATCCCGTCTACTTATATAGTATCAAGGACCTCTTAGCTATGCCTCTCTGCCTATACATCCGCGAATGTGATAGTGCACTGCGATGATCTGCTCTATGATCTGCTCTATCTGTTCCGTAGTTTTGTTGATTACTTCGTGCACTTCGAAACCCAGGAATTCCGAGTCACTGATGCTCCATTGAGGTGCTCCAGTCACACGTCCCGACGGAATATGCGACTATGAATTCGCAAATGCACCAGATGCCTTACCAAGGCTTCGAGGTTCACGTGGGTTCACGTGGCCAGCGAATTCCAAATAGTTCTAAACTCTGCTCAACCGAT

Full Affymetrix probeset data:

Annotations for 1637833_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720