Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637834_at:

>probe:Drosophila_2:1637834_at:702:549; Interrogation_Position=1814; Antisense; GGAGTGGTCTCCAATCTAGTCATGC
>probe:Drosophila_2:1637834_at:706:249; Interrogation_Position=1825; Antisense; CAATCTAGTCATGCCGCGATCAAAC
>probe:Drosophila_2:1637834_at:533:317; Interrogation_Position=1851; Antisense; GCCGTCCCACCATTAAAACGAGACA
>probe:Drosophila_2:1637834_at:381:479; Interrogation_Position=1895; Antisense; GTTTCATTCGCGCAATCGGTCTAAA
>probe:Drosophila_2:1637834_at:300:299; Interrogation_Position=1903; Antisense; CGCGCAATCGGTCTAAATCTTTTTT
>probe:Drosophila_2:1637834_at:323:675; Interrogation_Position=1926; Antisense; TTGGGTTTTTTGCACTTTGATTTCG
>probe:Drosophila_2:1637834_at:665:355; Interrogation_Position=1937; Antisense; GCACTTTGATTTCGCATTATTATTT
>probe:Drosophila_2:1637834_at:521:15; Interrogation_Position=1955; Antisense; ATTATTTTTATTTTGTGCCACAACA
>probe:Drosophila_2:1637834_at:411:729; Interrogation_Position=1967; Antisense; TTGTGCCACAACAACTGGTCACTGT
>probe:Drosophila_2:1637834_at:168:159; Interrogation_Position=1977; Antisense; ACAACTGGTCACTGTGTGATATATG
>probe:Drosophila_2:1637834_at:574:641; Interrogation_Position=2049; Antisense; TCTTTTTAGCCCCTTTATGTACATA
>probe:Drosophila_2:1637834_at:428:249; Interrogation_Position=2193; Antisense; CAATTTGCTTGTGTAATTTGTGTAA
>probe:Drosophila_2:1637834_at:156:221; Interrogation_Position=2294; Antisense; AAGTGTATAATAACGCATTGCGATT
>probe:Drosophila_2:1637834_at:49:135; Interrogation_Position=2306; Antisense; ACGCATTGCGATTGAATTAGTTAAT

Paste this into a BLAST search page for me
GGAGTGGTCTCCAATCTAGTCATGCCAATCTAGTCATGCCGCGATCAAACGCCGTCCCACCATTAAAACGAGACAGTTTCATTCGCGCAATCGGTCTAAACGCGCAATCGGTCTAAATCTTTTTTTTGGGTTTTTTGCACTTTGATTTCGGCACTTTGATTTCGCATTATTATTTATTATTTTTATTTTGTGCCACAACATTGTGCCACAACAACTGGTCACTGTACAACTGGTCACTGTGTGATATATGTCTTTTTAGCCCCTTTATGTACATACAATTTGCTTGTGTAATTTGTGTAAAAGTGTATAATAACGCATTGCGATTACGCATTGCGATTGAATTAGTTAAT

Full Affymetrix probeset data:

Annotations for 1637834_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime