FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637835_at:

>probe:Drosophila_2:1637835_at:713:387; Interrogation_Position=1228; Antisense; GAAAAGTATCCGGAGAACGTGCGCA
>probe:Drosophila_2:1637835_at:728:139; Interrogation_Position=1244; Antisense; ACGTGCGCATTATCGAGCTGGTGGA
>probe:Drosophila_2:1637835_at:66:333; Interrogation_Position=1260; Antisense; GCTGGTGGATGTCGAGTTCTTTAAA
>probe:Drosophila_2:1637835_at:425:427; Interrogation_Position=1273; Antisense; GAGTTCTTTAAACGGATCTGCGAAT
>probe:Drosophila_2:1637835_at:514:641; Interrogation_Position=1289; Antisense; TCTGCGAATGGATCGCCGGCTTGGA
>probe:Drosophila_2:1637835_at:550:143; Interrogation_Position=1326; Antisense; ACTCCGCGACACTCAATAAATCCAT
>probe:Drosophila_2:1637835_at:224:21; Interrogation_Position=1349; Antisense; ATATCTCTAGTAATTCCCGCCTTTT
>probe:Drosophila_2:1637835_at:247:695; Interrogation_Position=1372; Antisense; TTTCTTCGGCGCTATCATTTGATTC
>probe:Drosophila_2:1637835_at:515:385; Interrogation_Position=1466; Antisense; GAACAGGTGCACAACACGATCCATA
>probe:Drosophila_2:1637835_at:339:157; Interrogation_Position=1479; Antisense; ACACGATCCATAGAGCAGTTCCGAG
>probe:Drosophila_2:1637835_at:12:103; Interrogation_Position=1490; Antisense; AGAGCAGTTCCGAGATGGCACCAAC
>probe:Drosophila_2:1637835_at:63:67; Interrogation_Position=1504; Antisense; ATGGCACCAACCTAATCGGAATTTA
>probe:Drosophila_2:1637835_at:383:243; Interrogation_Position=1570; Antisense; AATTGGCTAGCTACCCAAATGGGTT
>probe:Drosophila_2:1637835_at:706:225; Interrogation_Position=1642; Antisense; AAGGCTTTAGTTTGTGCTATTTCAT

Paste this into a BLAST search page for me
GAAAAGTATCCGGAGAACGTGCGCAACGTGCGCATTATCGAGCTGGTGGAGCTGGTGGATGTCGAGTTCTTTAAAGAGTTCTTTAAACGGATCTGCGAATTCTGCGAATGGATCGCCGGCTTGGAACTCCGCGACACTCAATAAATCCATATATCTCTAGTAATTCCCGCCTTTTTTTCTTCGGCGCTATCATTTGATTCGAACAGGTGCACAACACGATCCATAACACGATCCATAGAGCAGTTCCGAGAGAGCAGTTCCGAGATGGCACCAACATGGCACCAACCTAATCGGAATTTAAATTGGCTAGCTACCCAAATGGGTTAAGGCTTTAGTTTGTGCTATTTCAT

Full Affymetrix probeset data:

Annotations for 1637835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720