Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637837_at:

>probe:Drosophila_2:1637837_at:167:623; Interrogation_Position=123; Antisense; TGCTGTAGCCATTCCACTGGAACTG
>probe:Drosophila_2:1637837_at:557:513; Interrogation_Position=160; Antisense; GTGTACATGGCCTTCAACTTTGAGT
>probe:Drosophila_2:1637837_at:503:147; Interrogation_Position=176; Antisense; ACTTTGAGTCCAACTATGCACTGCC
>probe:Drosophila_2:1637837_at:674:547; Interrogation_Position=243; Antisense; GGATGATCACTATCTGGGCGTCGGA
>probe:Drosophila_2:1637837_at:586:113; Interrogation_Position=391; Antisense; AGCATTATAAACTTCCTGACCCACT
>probe:Drosophila_2:1637837_at:680:283; Interrogation_Position=439; Antisense; CTGCTGCGAACAATCTGCGAGGTCA
>probe:Drosophila_2:1637837_at:462:365; Interrogation_Position=466; Antisense; GAATCGCCCCTGGATGATCAAAACG
>probe:Drosophila_2:1637837_at:391:525; Interrogation_Position=498; Antisense; GGGCAGCCTGTTTCAGATTCTATTC
>probe:Drosophila_2:1637837_at:580:461; Interrogation_Position=513; Antisense; GATTCTATTCATGCCAACGACAAGT
>probe:Drosophila_2:1637837_at:472:349; Interrogation_Position=558; Antisense; GCACGTGGACGAGCTCTACAAGGCC
>probe:Drosophila_2:1637837_at:527:487; Interrogation_Position=618; Antisense; GTACGTGGCCCACTGCGGACATAGT
>probe:Drosophila_2:1637837_at:394:289; Interrogation_Position=633; Antisense; CGGACATAGTGCTCTGGACCTGATA
>probe:Drosophila_2:1637837_at:310:355; Interrogation_Position=73; Antisense; GCACATTGTTTTCTGGTGTTTCCTC
>probe:Drosophila_2:1637837_at:600:637; Interrogation_Position=96; Antisense; TCGTCAGGGATCCTTTGGTCTACTG

Paste this into a BLAST search page for me
TGCTGTAGCCATTCCACTGGAACTGGTGTACATGGCCTTCAACTTTGAGTACTTTGAGTCCAACTATGCACTGCCGGATGATCACTATCTGGGCGTCGGAAGCATTATAAACTTCCTGACCCACTCTGCTGCGAACAATCTGCGAGGTCAGAATCGCCCCTGGATGATCAAAACGGGGCAGCCTGTTTCAGATTCTATTCGATTCTATTCATGCCAACGACAAGTGCACGTGGACGAGCTCTACAAGGCCGTACGTGGCCCACTGCGGACATAGTCGGACATAGTGCTCTGGACCTGATAGCACATTGTTTTCTGGTGTTTCCTCTCGTCAGGGATCCTTTGGTCTACTG

Full Affymetrix probeset data:

Annotations for 1637837_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime