FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637838_at:

>probe:Drosophila_2:1637838_at:642:411; Interrogation_Position=1840; Antisense; GACCATAGTGGCATCTACGACGACG
>probe:Drosophila_2:1637838_at:28:569; Interrogation_Position=1849; Antisense; GGCATCTACGACGACGGCATCGGCA
>probe:Drosophila_2:1637838_at:595:225; Interrogation_Position=1885; Antisense; AAGGCTACCGCACCCATGATCAATC
>probe:Drosophila_2:1637838_at:391:59; Interrogation_Position=1900; Antisense; ATGATCAATCCGTACAGCAGCGGGA
>probe:Drosophila_2:1637838_at:58:109; Interrogation_Position=2024; Antisense; AGAAGCCGCAGCACCTAAGCCTGGT
>probe:Drosophila_2:1637838_at:411:113; Interrogation_Position=2083; Antisense; AGCAGCAAGCCCAAGTACAGCCTGA
>probe:Drosophila_2:1637838_at:651:89; Interrogation_Position=2096; Antisense; AGTACAGCCTGACCCTGCACAACAG
>probe:Drosophila_2:1637838_at:650:311; Interrogation_Position=2168; Antisense; GCCAGCACCTCAAGGCCGTGGATGG
>probe:Drosophila_2:1637838_at:699:515; Interrogation_Position=2243; Antisense; GTGTGCACCTGAAGGCCGGCTCCGA
>probe:Drosophila_2:1637838_at:400:71; Interrogation_Position=2288; Antisense; AGGCTTCGGGCAGTGTCACCAGGCA
>probe:Drosophila_2:1637838_at:622:167; Interrogation_Position=2343; Antisense; AAAGGACGGCGCCAAATGCGGAAAT
>probe:Drosophila_2:1637838_at:543:321; Interrogation_Position=2351; Antisense; GCGCCAAATGCGGAAATGACAATGA
>probe:Drosophila_2:1637838_at:239:83; Interrogation_Position=2388; Antisense; AGTGGCAAACGGTGTCATGAGGACA
>probe:Drosophila_2:1637838_at:86:59; Interrogation_Position=2404; Antisense; ATGAGGACACAAAACAACAGGCTGT

Paste this into a BLAST search page for me
GACCATAGTGGCATCTACGACGACGGGCATCTACGACGACGGCATCGGCAAAGGCTACCGCACCCATGATCAATCATGATCAATCCGTACAGCAGCGGGAAGAAGCCGCAGCACCTAAGCCTGGTAGCAGCAAGCCCAAGTACAGCCTGAAGTACAGCCTGACCCTGCACAACAGGCCAGCACCTCAAGGCCGTGGATGGGTGTGCACCTGAAGGCCGGCTCCGAAGGCTTCGGGCAGTGTCACCAGGCAAAAGGACGGCGCCAAATGCGGAAATGCGCCAAATGCGGAAATGACAATGAAGTGGCAAACGGTGTCATGAGGACAATGAGGACACAAAACAACAGGCTGT

Full Affymetrix probeset data:

Annotations for 1637838_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720