FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637839_at:

>probe:Drosophila_2:1637839_at:207:135; Interrogation_Position=201; Antisense; ACGCCCTCGATGATGCAGTGAAAAC
>probe:Drosophila_2:1637839_at:399:451; Interrogation_Position=239; Antisense; GATCGTCCCCAGCTGAAGGAGCAAT
>probe:Drosophila_2:1637839_at:552:371; Interrogation_Position=253; Antisense; GAAGGAGCAATTCGGCCTGGTCAAC
>probe:Drosophila_2:1637839_at:548:289; Interrogation_Position=304; Antisense; CGTTTCCGTGGCTATAATGGCCCAT
>probe:Drosophila_2:1637839_at:324:657; Interrogation_Position=318; Antisense; TAATGGCCCATGCTTGGGACTTCAC
>probe:Drosophila_2:1637839_at:15:277; Interrogation_Position=376; Antisense; CTTCAGTGTTTTGGCCTACTTTGCA
>probe:Drosophila_2:1637839_at:673:721; Interrogation_Position=450; Antisense; TTGCGGTGGCCCTGCAGAAGGACAA
>probe:Drosophila_2:1637839_at:48:71; Interrogation_Position=495; Antisense; AGGCCAGCTCCGATATGCGCAAGTA
>probe:Drosophila_2:1637839_at:388:319; Interrogation_Position=602; Antisense; GCCGCCTTCATCGATCAGAATGGCA
>probe:Drosophila_2:1637839_at:324:371; Interrogation_Position=619; Antisense; GAATGGCATCGTCCTGGACAACCTG
>probe:Drosophila_2:1637839_at:212:523; Interrogation_Position=644; Antisense; GTGGCCAACGAGGTCAACCGTCTGT
>probe:Drosophila_2:1637839_at:596:651; Interrogation_Position=669; Antisense; TCAACGCCTTAGCTGCCGACAAGAA
>probe:Drosophila_2:1637839_at:360:107; Interrogation_Position=693; Antisense; AGAACGCTAGCAGCCTTTCTTCTAA
>probe:Drosophila_2:1637839_at:590:9; Interrogation_Position=727; Antisense; ATTCCCCACTTTTGTCTCATTAAAT

Paste this into a BLAST search page for me
ACGCCCTCGATGATGCAGTGAAAACGATCGTCCCCAGCTGAAGGAGCAATGAAGGAGCAATTCGGCCTGGTCAACCGTTTCCGTGGCTATAATGGCCCATTAATGGCCCATGCTTGGGACTTCACCTTCAGTGTTTTGGCCTACTTTGCATTGCGGTGGCCCTGCAGAAGGACAAAGGCCAGCTCCGATATGCGCAAGTAGCCGCCTTCATCGATCAGAATGGCAGAATGGCATCGTCCTGGACAACCTGGTGGCCAACGAGGTCAACCGTCTGTTCAACGCCTTAGCTGCCGACAAGAAAGAACGCTAGCAGCCTTTCTTCTAAATTCCCCACTTTTGTCTCATTAAAT

Full Affymetrix probeset data:

Annotations for 1637839_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720