FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637841_at:

>probe:Drosophila_2:1637841_at:543:493; Interrogation_Position=1018; Antisense; GTAATGTCTGCACCCGAAGTGGTCA
>probe:Drosophila_2:1637841_at:397:83; Interrogation_Position=1035; Antisense; AGTGGTCATCATTCCAAACGGCACC
>probe:Drosophila_2:1637841_at:51:239; Interrogation_Position=1080; Antisense; AATCTCTCAGATGAGCCTGGCGCAT
>probe:Drosophila_2:1637841_at:366:357; Interrogation_Position=1112; Antisense; GCAACCCCAGGCGACGGAATTTATT
>probe:Drosophila_2:1637841_at:203:623; Interrogation_Position=1147; Antisense; TGCGCGTAACTTTGTATTGACTCTT
>probe:Drosophila_2:1637841_at:544:13; Interrogation_Position=1210; Antisense; ATTACCACGATTTGGGTGCTTCCCA
>probe:Drosophila_2:1637841_at:235:507; Interrogation_Position=1225; Antisense; GTGCTTCCCAGATGCATAGGCTTGT
>probe:Drosophila_2:1637841_at:595:25; Interrogation_Position=1240; Antisense; ATAGGCTTGTCTATGCGCCACATAA
>probe:Drosophila_2:1637841_at:544:191; Interrogation_Position=1263; Antisense; AACTTCTGGCAGCACCAATTGCAGG
>probe:Drosophila_2:1637841_at:612:299; Interrogation_Position=1329; Antisense; CGCCGTTTTGCTTTTCTATATGTTT
>probe:Drosophila_2:1637841_at:478:591; Interrogation_Position=1424; Antisense; TGGGATAGTTTCTCTTACGCCAAAA
>probe:Drosophila_2:1637841_at:372:681; Interrogation_Position=913; Antisense; TATGTCTGCTGATCTTCATACTCGC
>probe:Drosophila_2:1637841_at:641:29; Interrogation_Position=930; Antisense; ATACTCGCCTTGTGTGTCGTCATAC
>probe:Drosophila_2:1637841_at:428:591; Interrogation_Position=958; Antisense; TGGTCTACGTCATCTACCTAGCAGA

Paste this into a BLAST search page for me
GTAATGTCTGCACCCGAAGTGGTCAAGTGGTCATCATTCCAAACGGCACCAATCTCTCAGATGAGCCTGGCGCATGCAACCCCAGGCGACGGAATTTATTTGCGCGTAACTTTGTATTGACTCTTATTACCACGATTTGGGTGCTTCCCAGTGCTTCCCAGATGCATAGGCTTGTATAGGCTTGTCTATGCGCCACATAAAACTTCTGGCAGCACCAATTGCAGGCGCCGTTTTGCTTTTCTATATGTTTTGGGATAGTTTCTCTTACGCCAAAATATGTCTGCTGATCTTCATACTCGCATACTCGCCTTGTGTGTCGTCATACTGGTCTACGTCATCTACCTAGCAGA

Full Affymetrix probeset data:

Annotations for 1637841_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720