FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637844_at:

>probe:Drosophila_2:1637844_at:640:101; Interrogation_Position=1630; Antisense; AGAGCATTCAGCAGGCTCCTGTGAT
>probe:Drosophila_2:1637844_at:130:605; Interrogation_Position=1651; Antisense; TGATTCAGCAGAGTTACACCGCTCC
>probe:Drosophila_2:1637844_at:456:9; Interrogation_Position=1689; Antisense; ATTCCTGAGCCCGTGCAGCAGATTG
>probe:Drosophila_2:1637844_at:538:263; Interrogation_Position=1716; Antisense; CAGCAGCCGCAGTACAGTGGTTACT
>probe:Drosophila_2:1637844_at:279:491; Interrogation_Position=1727; Antisense; GTACAGTGGTTACTCCTACCAGACT
>probe:Drosophila_2:1637844_at:229:195; Interrogation_Position=1849; Antisense; AACTGCAGCAGTCCTTTGTGCCAGC
>probe:Drosophila_2:1637844_at:516:5; Interrogation_Position=1914; Antisense; ATTGTACAGTACTCACCACCAGTGG
>probe:Drosophila_2:1637844_at:280:337; Interrogation_Position=1974; Antisense; GCTCCAATTCAAGTTGCCGCTGCAG
>probe:Drosophila_2:1637844_at:334:101; Interrogation_Position=2024; Antisense; AGAGATCGGAACCAACTACGCCGCC
>probe:Drosophila_2:1637844_at:210:133; Interrogation_Position=2041; Antisense; ACGCCGCCAATGGTGGTTACCTGTA
>probe:Drosophila_2:1637844_at:491:473; Interrogation_Position=2056; Antisense; GTTACCTGTACTAGGATGCCTGTGA
>probe:Drosophila_2:1637844_at:594:549; Interrogation_Position=2093; Antisense; GGAGGTCCGAACTCGCATCAAGTTG
>probe:Drosophila_2:1637844_at:451:385; Interrogation_Position=2137; Antisense; GAACTTAGTGTTACGTAGCCAATTT
>probe:Drosophila_2:1637844_at:334:487; Interrogation_Position=2151; Antisense; GTAGCCAATTTCTAGCACCTTATAA

Paste this into a BLAST search page for me
AGAGCATTCAGCAGGCTCCTGTGATTGATTCAGCAGAGTTACACCGCTCCATTCCTGAGCCCGTGCAGCAGATTGCAGCAGCCGCAGTACAGTGGTTACTGTACAGTGGTTACTCCTACCAGACTAACTGCAGCAGTCCTTTGTGCCAGCATTGTACAGTACTCACCACCAGTGGGCTCCAATTCAAGTTGCCGCTGCAGAGAGATCGGAACCAACTACGCCGCCACGCCGCCAATGGTGGTTACCTGTAGTTACCTGTACTAGGATGCCTGTGAGGAGGTCCGAACTCGCATCAAGTTGGAACTTAGTGTTACGTAGCCAATTTGTAGCCAATTTCTAGCACCTTATAA

Full Affymetrix probeset data:

Annotations for 1637844_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720