FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637846_at:

>probe:Drosophila_2:1637846_at:461:595; Interrogation_Position=124; Antisense; TGTGGCAAGCCGCAGTGCCTCTCTT
>probe:Drosophila_2:1637846_at:330:87; Interrogation_Position=137; Antisense; AGTGCCTCTCTTGCGGATCCAGATC
>probe:Drosophila_2:1637846_at:249:547; Interrogation_Position=151; Antisense; GGATCCAGATCCTGCGGATGTGGCT
>probe:Drosophila_2:1637846_at:19:549; Interrogation_Position=166; Antisense; GGATGTGGCTGCAACCCCTGTCGAT
>probe:Drosophila_2:1637846_at:618:597; Interrogation_Position=184; Antisense; TGTCGATGTCCTTCCTCTTCCGGGT
>probe:Drosophila_2:1637846_at:647:645; Interrogation_Position=199; Antisense; TCTTCCGGGTGTGGCTGCAAGGATT
>probe:Drosophila_2:1637846_at:82:251; Interrogation_Position=216; Antisense; CAAGGATTAATCCAGGACTCCAGGA
>probe:Drosophila_2:1637846_at:549:143; Interrogation_Position=232; Antisense; ACTCCAGGACCCCTTCAGAACTTTG
>probe:Drosophila_2:1637846_at:108:383; Interrogation_Position=249; Antisense; GAACTTTGCCTTCACAAAACCTTCG
>probe:Drosophila_2:1637846_at:298:489; Interrogation_Position=308; Antisense; GTACTGATACATTTTGCAAACTTTC
>probe:Drosophila_2:1637846_at:123:217; Interrogation_Position=37; Antisense; AAGTTAATCATCCTGGTTGCCCTGA
>probe:Drosophila_2:1637846_at:415:589; Interrogation_Position=50; Antisense; TGGTTGCCCTGACCATCTCCATGGT
>probe:Drosophila_2:1637846_at:103:39; Interrogation_Position=64; Antisense; ATCTCCATGGTCCAGAGCTGTTCCG
>probe:Drosophila_2:1637846_at:367:627; Interrogation_Position=74; Antisense; TCCAGAGCTGTTCCGTTGAGGAGCC

Paste this into a BLAST search page for me
TGTGGCAAGCCGCAGTGCCTCTCTTAGTGCCTCTCTTGCGGATCCAGATCGGATCCAGATCCTGCGGATGTGGCTGGATGTGGCTGCAACCCCTGTCGATTGTCGATGTCCTTCCTCTTCCGGGTTCTTCCGGGTGTGGCTGCAAGGATTCAAGGATTAATCCAGGACTCCAGGAACTCCAGGACCCCTTCAGAACTTTGGAACTTTGCCTTCACAAAACCTTCGGTACTGATACATTTTGCAAACTTTCAAGTTAATCATCCTGGTTGCCCTGATGGTTGCCCTGACCATCTCCATGGTATCTCCATGGTCCAGAGCTGTTCCGTCCAGAGCTGTTCCGTTGAGGAGCC

Full Affymetrix probeset data:

Annotations for 1637846_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720