FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637848_at:

>probe:Drosophila_2:1637848_at:485:655; Interrogation_Position=143; Antisense; TAAGGGAGGCGAACTACGACGACTT
>probe:Drosophila_2:1637848_at:178:583; Interrogation_Position=170; Antisense; TGGCGGATCTGCAACGTGCCGGATC
>probe:Drosophila_2:1637848_at:528:505; Interrogation_Position=185; Antisense; GTGCCGGATCCAATCAGTGCCGATT
>probe:Drosophila_2:1637848_at:244:319; Interrogation_Position=203; Antisense; GCCGATTCGCTGTCTACGACTATGA
>probe:Drosophila_2:1637848_at:155:431; Interrogation_Position=226; Antisense; GAGTATCAGCACCAGTGCCAGGGCA
>probe:Drosophila_2:1637848_at:728:207; Interrogation_Position=274; Antisense; AAGCTAATCCTGATGCTCTGGTGTC
>probe:Drosophila_2:1637848_at:46:245; Interrogation_Position=28; Antisense; AATTTGAGCCGCGAGTGTCAGCACG
>probe:Drosophila_2:1637848_at:136:215; Interrogation_Position=322; Antisense; AAGATGCTCTACTCCAGCACGTTTG
>probe:Drosophila_2:1637848_at:157:261; Interrogation_Position=339; Antisense; CACGTTTGCGGTGCTCAAGCGAGAG
>probe:Drosophila_2:1637848_at:629:249; Interrogation_Position=354; Antisense; CAAGCGAGAGTTTCCCGGCGTCCAG
>probe:Drosophila_2:1637848_at:20:111; Interrogation_Position=377; Antisense; AGAAGTGCATTCAGGCCACCGAACC
>probe:Drosophila_2:1637848_at:675:599; Interrogation_Position=43; Antisense; TGTCAGCACGTGTTCGAGCAGATCC
>probe:Drosophila_2:1637848_at:323:119; Interrogation_Position=434; Antisense; AGCTGCGCTCCTTGGACAGGGAGTA
>probe:Drosophila_2:1637848_at:385:377; Interrogation_Position=75; Antisense; GAAGCAACATCGCTACGCGGTCTTC

Paste this into a BLAST search page for me
TAAGGGAGGCGAACTACGACGACTTTGGCGGATCTGCAACGTGCCGGATCGTGCCGGATCCAATCAGTGCCGATTGCCGATTCGCTGTCTACGACTATGAGAGTATCAGCACCAGTGCCAGGGCAAAGCTAATCCTGATGCTCTGGTGTCAATTTGAGCCGCGAGTGTCAGCACGAAGATGCTCTACTCCAGCACGTTTGCACGTTTGCGGTGCTCAAGCGAGAGCAAGCGAGAGTTTCCCGGCGTCCAGAGAAGTGCATTCAGGCCACCGAACCTGTCAGCACGTGTTCGAGCAGATCCAGCTGCGCTCCTTGGACAGGGAGTAGAAGCAACATCGCTACGCGGTCTTC

Full Affymetrix probeset data:

Annotations for 1637848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720