FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637849_at:

>probe:Drosophila_2:1637849_at:614:487; Interrogation_Position=1028; Antisense; GTACCAGACGAAGAGCACCAGCAGC
>probe:Drosophila_2:1637849_at:625:563; Interrogation_Position=1083; Antisense; GGAAGAGTGGAAACTCCGCCACCAC
>probe:Drosophila_2:1637849_at:131:711; Interrogation_Position=1149; Antisense; TTCAGCATCGAATCCCTGTTGGGAT
>probe:Drosophila_2:1637849_at:544:675; Interrogation_Position=1209; Antisense; TATGATTTCGGGTGGTTAGCTAAGC
>probe:Drosophila_2:1637849_at:623:263; Interrogation_Position=648; Antisense; CAGAATCGTCGTGCCAAATGGCGTA
>probe:Drosophila_2:1637849_at:371:587; Interrogation_Position=698; Antisense; TGGACGACCAGCTCATAATGCCCAC
>probe:Drosophila_2:1637849_at:12:593; Interrogation_Position=737; Antisense; TGGTGACCCCATTCCATTGAGCGAA
>probe:Drosophila_2:1637849_at:60:101; Interrogation_Position=771; Antisense; AGAGAACTAGCCCAGCGCAGCAAGC
>probe:Drosophila_2:1637849_at:84:391; Interrogation_Position=803; Antisense; GAAAGCCATCGATCGGCAGGCGAAG
>probe:Drosophila_2:1637849_at:608:583; Interrogation_Position=847; Antisense; TGGAAGTGGACTATGCCCGTCTGGA
>probe:Drosophila_2:1637849_at:62:589; Interrogation_Position=868; Antisense; TGGAGGCCGAGTACCTAGCTGCCCA
>probe:Drosophila_2:1637849_at:41:675; Interrogation_Position=883; Antisense; TAGCTGCCCACCAGGAGAACGGAGT
>probe:Drosophila_2:1637849_at:210:671; Interrogation_Position=981; Antisense; TACGTGACCGGCGACAGTTTGGATC
>probe:Drosophila_2:1637849_at:540:153; Interrogation_Position=994; Antisense; ACAGTTTGGATCACTCGTTCTGCTC

Paste this into a BLAST search page for me
GTACCAGACGAAGAGCACCAGCAGCGGAAGAGTGGAAACTCCGCCACCACTTCAGCATCGAATCCCTGTTGGGATTATGATTTCGGGTGGTTAGCTAAGCCAGAATCGTCGTGCCAAATGGCGTATGGACGACCAGCTCATAATGCCCACTGGTGACCCCATTCCATTGAGCGAAAGAGAACTAGCCCAGCGCAGCAAGCGAAAGCCATCGATCGGCAGGCGAAGTGGAAGTGGACTATGCCCGTCTGGATGGAGGCCGAGTACCTAGCTGCCCATAGCTGCCCACCAGGAGAACGGAGTTACGTGACCGGCGACAGTTTGGATCACAGTTTGGATCACTCGTTCTGCTC

Full Affymetrix probeset data:

Annotations for 1637849_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720