Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637850_at:

>probe:Drosophila_2:1637850_at:236:27; Interrogation_Position=2648; Antisense; ATACTGCGAAATGCATCGGAAATTT
>probe:Drosophila_2:1637850_at:36:345; Interrogation_Position=2660; Antisense; GCATCGGAAATTTTTATTATACACA
>probe:Drosophila_2:1637850_at:546:703; Interrogation_Position=2676; Antisense; TTATACACAAGCCAGTAGCCACGCT
>probe:Drosophila_2:1637850_at:613:671; Interrogation_Position=2691; Antisense; TAGCCACGCTACAAAAACATTCCAT
>probe:Drosophila_2:1637850_at:115:179; Interrogation_Position=2705; Antisense; AAACATTCCATTTCCCTCTTTAGCT
>probe:Drosophila_2:1637850_at:696:629; Interrogation_Position=2711; Antisense; TCCATTTCCCTCTTTAGCTTTCTAA
>probe:Drosophila_2:1637850_at:293:639; Interrogation_Position=2724; Antisense; TTAGCTTTCTAAAAAGTCGAAGACA
>probe:Drosophila_2:1637850_at:322:389; Interrogation_Position=2761; Antisense; GAAAAATTTGTTTCTGTACATACAG
>probe:Drosophila_2:1637850_at:411:489; Interrogation_Position=2776; Antisense; GTACATACAGTTTTGTTGCATTTTT
>probe:Drosophila_2:1637850_at:324:391; Interrogation_Position=2813; Antisense; GAAATTCGTAGCATTAAAAATCCCA
>probe:Drosophila_2:1637850_at:508:357; Interrogation_Position=2863; Antisense; GCAACAAGACAAAACAGCGATTTAT
>probe:Drosophila_2:1637850_at:532:261; Interrogation_Position=2877; Antisense; CAGCGATTTATTTAAGTGTAAGCGA
>probe:Drosophila_2:1637850_at:264:513; Interrogation_Position=2892; Antisense; GTGTAAGCGAAATGCCTAACATAAA
>probe:Drosophila_2:1637850_at:252:393; Interrogation_Position=2926; Antisense; GAAATCCCAAATGATGACAAAGAAT

Paste this into a BLAST search page for me
ATACTGCGAAATGCATCGGAAATTTGCATCGGAAATTTTTATTATACACATTATACACAAGCCAGTAGCCACGCTTAGCCACGCTACAAAAACATTCCATAAACATTCCATTTCCCTCTTTAGCTTCCATTTCCCTCTTTAGCTTTCTAATTAGCTTTCTAAAAAGTCGAAGACAGAAAAATTTGTTTCTGTACATACAGGTACATACAGTTTTGTTGCATTTTTGAAATTCGTAGCATTAAAAATCCCAGCAACAAGACAAAACAGCGATTTATCAGCGATTTATTTAAGTGTAAGCGAGTGTAAGCGAAATGCCTAACATAAAGAAATCCCAAATGATGACAAAGAAT

Full Affymetrix probeset data:

Annotations for 1637850_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime