Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637851_at:

>probe:Drosophila_2:1637851_at:150:489; Interrogation_Position=247; Antisense; GTACGATTCTGTATCAATCCGCAAG
>probe:Drosophila_2:1637851_at:706:67; Interrogation_Position=338; Antisense; ATGGCAGCTTGGCATTCTCATTCTT
>probe:Drosophila_2:1637851_at:369:169; Interrogation_Position=372; Antisense; AAATGGTTCTGGTCACGAAGTATAC
>probe:Drosophila_2:1637851_at:299:177; Interrogation_Position=445; Antisense; AAACTGGATGATTCGCACAACCTGC
>probe:Drosophila_2:1637851_at:118:47; Interrogation_Position=482; Antisense; ATGCCAGTTCAGAGGGCGAAACTTC
>probe:Drosophila_2:1637851_at:317:67; Interrogation_Position=524; Antisense; ATGGCACTGATGCATCCGCATATCC
>probe:Drosophila_2:1637851_at:480:23; Interrogation_Position=543; Antisense; ATATCCGCCATTTCGCCAACGAGGG
>probe:Drosophila_2:1637851_at:168:715; Interrogation_Position=570; Antisense; TTCGATGTACATTTTTAGCGCAGAT
>probe:Drosophila_2:1637851_at:337:123; Interrogation_Position=586; Antisense; AGCGCAGATATTTGCAGATCGGTGC
>probe:Drosophila_2:1637851_at:395:527; Interrogation_Position=606; Antisense; GGTGCAGTTATTCTACCAAACCGAT
>probe:Drosophila_2:1637851_at:306:583; Interrogation_Position=669; Antisense; TGGCGAGAACTTTATCAACGACATT
>probe:Drosophila_2:1637851_at:358:253; Interrogation_Position=684; Antisense; CAACGACATTGGTCCGGAACATGAT
>probe:Drosophila_2:1637851_at:278:659; Interrogation_Position=708; Antisense; TAACGAGTGCTTCTGTGTTGACAAA
>probe:Drosophila_2:1637851_at:544:271; Interrogation_Position=780; Antisense; CTTGGATTTGACCACCTGTTTGGGT

Paste this into a BLAST search page for me
GTACGATTCTGTATCAATCCGCAAGATGGCAGCTTGGCATTCTCATTCTTAAATGGTTCTGGTCACGAAGTATACAAACTGGATGATTCGCACAACCTGCATGCCAGTTCAGAGGGCGAAACTTCATGGCACTGATGCATCCGCATATCCATATCCGCCATTTCGCCAACGAGGGTTCGATGTACATTTTTAGCGCAGATAGCGCAGATATTTGCAGATCGGTGCGGTGCAGTTATTCTACCAAACCGATTGGCGAGAACTTTATCAACGACATTCAACGACATTGGTCCGGAACATGATTAACGAGTGCTTCTGTGTTGACAAACTTGGATTTGACCACCTGTTTGGGT

Full Affymetrix probeset data:

Annotations for 1637851_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime