FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637852_at:

>probe:Drosophila_2:1637852_at:201:437; Interrogation_Position=201; Antisense; GAGGAGGACCCAATCGAATTCGAGT
>probe:Drosophila_2:1637852_at:191:205; Interrogation_Position=292; Antisense; AAGCGGACTCCATCATCGACGATAT
>probe:Drosophila_2:1637852_at:216:381; Interrogation_Position=374; Antisense; GAACGACCTGCGCAAGATGTATGAA
>probe:Drosophila_2:1637852_at:99:601; Interrogation_Position=391; Antisense; TGTATGAACTAAGTCTACTCCCGCC
>probe:Drosophila_2:1637852_at:405:543; Interrogation_Position=40; Antisense; GGATTTTAAACCTGTCATTCCAGCA
>probe:Drosophila_2:1637852_at:138:27; Interrogation_Position=423; Antisense; ATAGCTGCCCAGATCCAGCAAATGG
>probe:Drosophila_2:1637852_at:542:223; Interrogation_Position=450; Antisense; AAGGAGATCTACGAGCTGAGTCAAT
>probe:Drosophila_2:1637852_at:668:229; Interrogation_Position=472; Antisense; AATGGGAAGCCAGGGAGCTCATCCG
>probe:Drosophila_2:1637852_at:28:553; Interrogation_Position=485; Antisense; GGAGCTCATCCGGAGCAAACACCTG
>probe:Drosophila_2:1637852_at:107:181; Interrogation_Position=501; Antisense; AAACACCTGCGCATCTTTGGCAACT
>probe:Drosophila_2:1637852_at:110:293; Interrogation_Position=528; Antisense; CGTCGTCGCGCCAACAAGTGAAGAA
>probe:Drosophila_2:1637852_at:511:685; Interrogation_Position=579; Antisense; TATACTGTACTGTTGATGACTTTGA
>probe:Drosophila_2:1637852_at:656:207; Interrogation_Position=80; Antisense; AAGCTAATTTCTTGGGTCCCTTCTG
>probe:Drosophila_2:1637852_at:531:531; Interrogation_Position=93; Antisense; GGGTCCCTTCTGTTTTGATATATTC

Paste this into a BLAST search page for me
GAGGAGGACCCAATCGAATTCGAGTAAGCGGACTCCATCATCGACGATATGAACGACCTGCGCAAGATGTATGAATGTATGAACTAAGTCTACTCCCGCCGGATTTTAAACCTGTCATTCCAGCAATAGCTGCCCAGATCCAGCAAATGGAAGGAGATCTACGAGCTGAGTCAATAATGGGAAGCCAGGGAGCTCATCCGGGAGCTCATCCGGAGCAAACACCTGAAACACCTGCGCATCTTTGGCAACTCGTCGTCGCGCCAACAAGTGAAGAATATACTGTACTGTTGATGACTTTGAAAGCTAATTTCTTGGGTCCCTTCTGGGGTCCCTTCTGTTTTGATATATTC

Full Affymetrix probeset data:

Annotations for 1637852_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720