FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637856_at:

>probe:Drosophila_2:1637856_at:103:371; Interrogation_Position=126; Antisense; GAAGGCGGCCTTGAGCCACCAACGG
>probe:Drosophila_2:1637856_at:610:57; Interrogation_Position=13; Antisense; ATGAGGCTCACGTTGGCCTGGCTCA
>probe:Drosophila_2:1637856_at:224:225; Interrogation_Position=181; Antisense; AAGGATGCACGCGTCCTGTTTGACA
>probe:Drosophila_2:1637856_at:702:445; Interrogation_Position=214; Antisense; GATGCACTGCGCGATATGATGCACA
>probe:Drosophila_2:1637856_at:603:361; Interrogation_Position=254; Antisense; GCAATGGACCCATGGATTCTGGAAA
>probe:Drosophila_2:1637856_at:327:245; Interrogation_Position=278; Antisense; AATTTAGCCTGTCCGATGTGGAGCA
>probe:Drosophila_2:1637856_at:659:261; Interrogation_Position=308; Antisense; CAGCGCAGCGCTCTGAGGATTTTAA
>probe:Drosophila_2:1637856_at:25:237; Interrogation_Position=362; Antisense; AATCAGCGCCGCAGGAAATTGCAAT
>probe:Drosophila_2:1637856_at:339:643; Interrogation_Position=41; Antisense; TCTGCCTGGCGATTTATTGCGGCGG
>probe:Drosophila_2:1637856_at:271:449; Interrogation_Position=479; Antisense; GATCCGGCGGATCTGGAACCAGCAA
>probe:Drosophila_2:1637856_at:616:379; Interrogation_Position=494; Antisense; GAACCAGCAAGTGTCCGCAGGAATA
>probe:Drosophila_2:1637856_at:563:365; Interrogation_Position=514; Antisense; GAATACTATCGCACCATGCTGGCGG
>probe:Drosophila_2:1637856_at:83:309; Interrogation_Position=69; Antisense; CCATGGCCATGGCAATGTGGTCCTA
>probe:Drosophila_2:1637856_at:449:229; Interrogation_Position=82; Antisense; AATGTGGTCCTATCTTTGCCACCAT

Paste this into a BLAST search page for me
GAAGGCGGCCTTGAGCCACCAACGGATGAGGCTCACGTTGGCCTGGCTCAAAGGATGCACGCGTCCTGTTTGACAGATGCACTGCGCGATATGATGCACAGCAATGGACCCATGGATTCTGGAAAAATTTAGCCTGTCCGATGTGGAGCACAGCGCAGCGCTCTGAGGATTTTAAAATCAGCGCCGCAGGAAATTGCAATTCTGCCTGGCGATTTATTGCGGCGGGATCCGGCGGATCTGGAACCAGCAAGAACCAGCAAGTGTCCGCAGGAATAGAATACTATCGCACCATGCTGGCGGCCATGGCCATGGCAATGTGGTCCTAAATGTGGTCCTATCTTTGCCACCAT

Full Affymetrix probeset data:

Annotations for 1637856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720