FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637857_at:

>probe:Drosophila_2:1637857_at:500:371; Interrogation_Position=262; Antisense; GACGTTTCCAACATAAAGGCATCGC
>probe:Drosophila_2:1637857_at:191:169; Interrogation_Position=276; Antisense; AAAGGCATCGCAGCTGTCAAAGGAT
>probe:Drosophila_2:1637857_at:122:351; Interrogation_Position=327; Antisense; GCAGTTTGCCATGCATGAATCTTTG
>probe:Drosophila_2:1637857_at:106:551; Interrogation_Position=351; Antisense; GGAGACCATCAATCGGTATCTTACA
>probe:Drosophila_2:1637857_at:285:297; Interrogation_Position=392; Antisense; CGAAATTGCAGCTTGAGGCGATCAA
>probe:Drosophila_2:1637857_at:371:575; Interrogation_Position=438; Antisense; GGCCCAAATGGATGGCTATTTCTCA
>probe:Drosophila_2:1637857_at:310:229; Interrogation_Position=469; Antisense; AATGGAGTTCAATGCCTACAGCCAG
>probe:Drosophila_2:1637857_at:272:447; Interrogation_Position=556; Antisense; GATGCTCAGGCCAAATGTCGTCGAA
>probe:Drosophila_2:1637857_at:43:369; Interrogation_Position=578; Antisense; GAATGGGAGGTCACCTAGCCTCTAT
>probe:Drosophila_2:1637857_at:632:395; Interrogation_Position=651; Antisense; GAAATCATACTTCCTGGGCGTCAAC
>probe:Drosophila_2:1637857_at:556:175; Interrogation_Position=686; Antisense; AAACCGGTGACTTTGTGTCTGCAGC
>probe:Drosophila_2:1637857_at:565:513; Interrogation_Position=700; Antisense; GTGTCTGCAGCCTCCGGAAAAAGTT
>probe:Drosophila_2:1637857_at:570:417; Interrogation_Position=775; Antisense; GAGCGATGCGTTTCAATCTTGCGAA
>probe:Drosophila_2:1637857_at:76:297; Interrogation_Position=795; Antisense; GCGAAAACTCATGCATGTGGGCAAT

Paste this into a BLAST search page for me
GACGTTTCCAACATAAAGGCATCGCAAAGGCATCGCAGCTGTCAAAGGATGCAGTTTGCCATGCATGAATCTTTGGGAGACCATCAATCGGTATCTTACACGAAATTGCAGCTTGAGGCGATCAAGGCCCAAATGGATGGCTATTTCTCAAATGGAGTTCAATGCCTACAGCCAGGATGCTCAGGCCAAATGTCGTCGAAGAATGGGAGGTCACCTAGCCTCTATGAAATCATACTTCCTGGGCGTCAACAAACCGGTGACTTTGTGTCTGCAGCGTGTCTGCAGCCTCCGGAAAAAGTTGAGCGATGCGTTTCAATCTTGCGAAGCGAAAACTCATGCATGTGGGCAAT

Full Affymetrix probeset data:

Annotations for 1637857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720