FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637858_at:

>probe:Drosophila_2:1637858_at:633:313; Interrogation_Position=1489; Antisense; GCCAGGATCTTTCGCAGCTATCGAA
>probe:Drosophila_2:1637858_at:17:683; Interrogation_Position=1507; Antisense; TATCGAATCAGCACGGAGGCCCGCT
>probe:Drosophila_2:1637858_at:9:207; Interrogation_Position=1567; Antisense; AAGCTTAAGGATTACCCGCTGTGCC
>probe:Drosophila_2:1637858_at:150:23; Interrogation_Position=1620; Antisense; ATATGCCCCACAACCGGAAATTGAG
>probe:Drosophila_2:1637858_at:706:427; Interrogation_Position=1642; Antisense; GAGTTTGTTTCATCTTTTGCTGTTG
>probe:Drosophila_2:1637858_at:45:593; Interrogation_Position=1657; Antisense; TTTGCTGTTGACCTCGTTAACGATG
>probe:Drosophila_2:1637858_at:250:461; Interrogation_Position=1733; Antisense; GATTTCAGTTTGCACTTGTTCCAGC
>probe:Drosophila_2:1637858_at:709:189; Interrogation_Position=1766; Antisense; AACTTTGCAGCACACGTTGCGTATA
>probe:Drosophila_2:1637858_at:531:9; Interrogation_Position=1809; Antisense; ATTCCTTCGAAGATTGGCTGCTGCA
>probe:Drosophila_2:1637858_at:431:583; Interrogation_Position=1823; Antisense; TGGCTGCTGCAACTGGGCTATCTCT
>probe:Drosophila_2:1637858_at:430:37; Interrogation_Position=1842; Antisense; ATCTCTCGCAGTTGAGGGCTGGTCA
>probe:Drosophila_2:1637858_at:722:589; Interrogation_Position=1861; Antisense; TGGTCAAAGTTCTTGCACCCGATGA
>probe:Drosophila_2:1637858_at:432:591; Interrogation_Position=1909; Antisense; TGGTGGAGCCGACCTGCCAATTCAT
>probe:Drosophila_2:1637858_at:168:311; Interrogation_Position=1925; Antisense; CCAATTCATCGCTTTTCATTACTCA

Paste this into a BLAST search page for me
GCCAGGATCTTTCGCAGCTATCGAATATCGAATCAGCACGGAGGCCCGCTAAGCTTAAGGATTACCCGCTGTGCCATATGCCCCACAACCGGAAATTGAGGAGTTTGTTTCATCTTTTGCTGTTGTTTGCTGTTGACCTCGTTAACGATGGATTTCAGTTTGCACTTGTTCCAGCAACTTTGCAGCACACGTTGCGTATAATTCCTTCGAAGATTGGCTGCTGCATGGCTGCTGCAACTGGGCTATCTCTATCTCTCGCAGTTGAGGGCTGGTCATGGTCAAAGTTCTTGCACCCGATGATGGTGGAGCCGACCTGCCAATTCATCCAATTCATCGCTTTTCATTACTCA

Full Affymetrix probeset data:

Annotations for 1637858_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720