Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637859_at:

>probe:Drosophila_2:1637859_at:379:595; Interrogation_Position=1656; Antisense; TGTAGGCTTAGGTTGTCATGTAAAT
>probe:Drosophila_2:1637859_at:625:301; Interrogation_Position=1715; Antisense; CCCGTTATCTTTTACGCTCTAAGTG
>probe:Drosophila_2:1637859_at:375:135; Interrogation_Position=1728; Antisense; ACGCTCTAAGTGTACATGCAATGAT
>probe:Drosophila_2:1637859_at:715:673; Interrogation_Position=1775; Antisense; TAGAAGACGGAATTAAGCCCAACCA
>probe:Drosophila_2:1637859_at:450:163; Interrogation_Position=1802; Antisense; AAATATGTTGGTGTCTAGACCGTTG
>probe:Drosophila_2:1637859_at:697:495; Interrogation_Position=1814; Antisense; GTCTAGACCGTTGTGAGTTTTGTTT
>probe:Drosophila_2:1637859_at:720:661; Interrogation_Position=1864; Antisense; TAAAACCGATTAGTCTCCTTTGAGT
>probe:Drosophila_2:1637859_at:528:499; Interrogation_Position=1876; Antisense; GTCTCCTTTGAGTAAGTCTTTTACT
>probe:Drosophila_2:1637859_at:362:559; Interrogation_Position=1922; Antisense; GGACAGCGAGATTTCTGGGACATAT
>probe:Drosophila_2:1637859_at:587:527; Interrogation_Position=1938; Antisense; GGGACATATCTAGTGGTTGCTGAAA
>probe:Drosophila_2:1637859_at:184:513; Interrogation_Position=1965; Antisense; GTGTCAGTTACAGTTTACAAGGTTA
>probe:Drosophila_2:1637859_at:389:385; Interrogation_Position=1990; Antisense; GAACAGTTATTTACCTAGATACACA
>probe:Drosophila_2:1637859_at:185:681; Interrogation_Position=2028; Antisense; TATGGCCATATATACAGCTGCGAAA
>probe:Drosophila_2:1637859_at:391:705; Interrogation_Position=2062; Antisense; TTACCACTTGCCCAATCAAGGTTTG

Paste this into a BLAST search page for me
TGTAGGCTTAGGTTGTCATGTAAATCCCGTTATCTTTTACGCTCTAAGTGACGCTCTAAGTGTACATGCAATGATTAGAAGACGGAATTAAGCCCAACCAAAATATGTTGGTGTCTAGACCGTTGGTCTAGACCGTTGTGAGTTTTGTTTTAAAACCGATTAGTCTCCTTTGAGTGTCTCCTTTGAGTAAGTCTTTTACTGGACAGCGAGATTTCTGGGACATATGGGACATATCTAGTGGTTGCTGAAAGTGTCAGTTACAGTTTACAAGGTTAGAACAGTTATTTACCTAGATACACATATGGCCATATATACAGCTGCGAAATTACCACTTGCCCAATCAAGGTTTG

Full Affymetrix probeset data:

Annotations for 1637859_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime