FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637860_at:

>probe:Drosophila_2:1637860_at:280:201; Interrogation_Position=3117; Antisense; AACGCGCATCAATTGGGTGGTACAG
>probe:Drosophila_2:1637860_at:454:99; Interrogation_Position=3140; Antisense; AGAGCGGTGCAGTGGACTTCCTTCA
>probe:Drosophila_2:1637860_at:406:475; Interrogation_Position=3205; Antisense; GTTAGATTCTGCTTGAGCTTCCATG
>probe:Drosophila_2:1637860_at:590:445; Interrogation_Position=3229; Antisense; GATGAATTGCGCTACTTGGTCAAGG
>probe:Drosophila_2:1637860_at:15:539; Interrogation_Position=3246; Antisense; GGTCAAGGAAGAGCTATCGCCCAAA
>probe:Drosophila_2:1637860_at:408:581; Interrogation_Position=3278; Antisense; TGGCCATGCACATCACAAACCTAAT
>probe:Drosophila_2:1637860_at:325:657; Interrogation_Position=3299; Antisense; TAATGACGCGCTCCTTTTGTGTGTC
>probe:Drosophila_2:1637860_at:706:711; Interrogation_Position=3361; Antisense; TTCTTCTCGTCCGTGGAGGTAGACA
>probe:Drosophila_2:1637860_at:471:79; Interrogation_Position=3377; Antisense; AGGTAGACACTGTGCTGCGCAAGGA
>probe:Drosophila_2:1637860_at:302:269; Interrogation_Position=3408; Antisense; CATGGACTGCAAGACGCCCTCGAAT
>probe:Drosophila_2:1637860_at:177:69; Interrogation_Position=3437; Antisense; ATGGCCTGCGCATCGGCTATGGTAT
>probe:Drosophila_2:1637860_at:446:63; Interrogation_Position=3455; Antisense; ATGGTATTCAGCCTGGTCAGAGCTT
>probe:Drosophila_2:1637860_at:87:567; Interrogation_Position=3511; Antisense; GGCAACGATGTCAGTCAGTGGGATT
>probe:Drosophila_2:1637860_at:600:67; Interrogation_Position=3618; Antisense; AGGCTGTTACTAGTTCCTCTTAAAT

Paste this into a BLAST search page for me
AACGCGCATCAATTGGGTGGTACAGAGAGCGGTGCAGTGGACTTCCTTCAGTTAGATTCTGCTTGAGCTTCCATGGATGAATTGCGCTACTTGGTCAAGGGGTCAAGGAAGAGCTATCGCCCAAATGGCCATGCACATCACAAACCTAATTAATGACGCGCTCCTTTTGTGTGTCTTCTTCTCGTCCGTGGAGGTAGACAAGGTAGACACTGTGCTGCGCAAGGACATGGACTGCAAGACGCCCTCGAATATGGCCTGCGCATCGGCTATGGTATATGGTATTCAGCCTGGTCAGAGCTTGGCAACGATGTCAGTCAGTGGGATTAGGCTGTTACTAGTTCCTCTTAAAT

Full Affymetrix probeset data:

Annotations for 1637860_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720